Minimum Wage is a frequent topic of political debate. Analyze the pros Essay

Minimum Wage is a frequent topic of political debate. Analyze the pros and cons of such a policy using the relevant theoretical - Essay Example This made it a requirement of all states to set this as their minimum wage limit but this does not make it mandatory because some states exhibit variations of this set minimum. Some states, like California, have higher limits of this wage, which is at $8.00 while others, like Georgia, have wage limits below that federal limit at $5.15 per hour. These differences are made possible, by the municipal and state laws, which make it possible, for individual states to set their own minimum wage limits by exercising their right to enact their own by laws. This enables them to determine the limit of minimum wage, with respect to the economic potential of that a given state because it would not make sense to match the minimum wage with a rich state in terms of resources. This is an analytical discussion about the advantages and disadvantages of the minimum wage policy in the United States of America using a theoretical construct approach. Minimum wage from an economists view is disadvantageous to the market system of demand and supply. This is because when the minimum wage is raised the number of people vying for that job position increase, but the employer’s willingness to offer the position decreases because it is an increase in expenses in terms of salaries. In this scenario, employers would rather delegate the duties to be filled, by the new position to existing employees, than offering the job position. On the other hand, if the minimum wage were reduced, it would give employers an opportunity to create more job opportunities in organizations because they can afford to do so. This would depend on the amount of the wage set because a minimum wage of $1 per hour would not attract anyone, but student workers could consider a $4 per hour. Setting up the minimum wage law disrupted the functioning of supply and demand system because it dictates what employers should pay, instead of letting the two factors standardize the field on their own. Market factors of demand and supply govern the number and type of jobs available along what each job category would pay (Schmidt, 19). Increasing the minimum wage deprives a group of young Americans the much needed life lessons, which can be acquired when one works minimum wage job. This is because these jobs are popular with interns, workers in training and students, which help them, learn early in life how to handle money and relate with people in different circumstances (Schmidt, 16). They instill the values of hard work, responsibility and hard work early in their lives and motivate them to aspire to go to college and acquire advanced skills, which can enable them get better paying jobs in the future. Raising the minimum wage reduces the number of these types of jobs because employers will not be willing to offer these job positions because of increased salaries. This will translate to the emergence of a generation of Americans who have no value for hard work and responsibility, which would be detrimen tal to the economy of the country. It means that most of the American society in the future will lack a driving force that is essential in inculcating work ethics that are vital to a vibrant economy characterized by a work force that knows and understands the benefits of hard work. An increase in the minimum wage will result in a decrease of job opportunities that offer invaluable experience that is a prerequisite in almost all well paying and stimulating jobs in America. New entrants into

Graphic Novels in education Essay Example for Free

Graphic Novels in education Essay Graphic novels and comic books have been some of the most debated topics recently in many different areas. Many people think that they could be helpful in education, while some others completely disagree. Some people think they are childish, and some think they require just as much comprehension as long, fictional novels. However, despite all the criticism graphic novels often get, the genre is growing recently. Many things have led to this rise in interest, from easier access on the Internet to the many superhero movies sparking interest in a younger audience. Due to this recent rise in popularity for graphic novels, several people believe that this genre can be helpful in all levels of education. There are positives and negatives to this possibility, like everything else, but the positives seem to outweigh the negatives. One thing that weighs in favor of adding more graphic novels into education is that they are easier to read and can be more encouraging for students who may not like to read. There are several things that one must be able to do to read and understand graphic novels, including comprehending visual imagery and making inferences. The biggest factors that are helping push graphic novels into education are what was just mentioned; the way students now learn, the need to make inferences, and the need for students to learn visually. Every teacher can admit to having a few students in class that were not particularly good readers or that did not enjoy reading. If graphic novels were read more widely in classrooms, that would help with these certain students learning. The vocabulary and diction used in this genre is much simpler than in most word-based novels that would be read in class. Often, students who are given a very long book, they simply do not even read for their assignments. However, if one of these same students was given a longer graphic novel, like Watchmen for example, it is very likely that they would be more willing to read. Another method that makes these works easier for some students is that the words are more spread out, which makes the student only comprehend small parts at a time. This makes students who are less confident with their reading skills able to better manage comprehending the purpose in a novel. Although the speech in graphic novels is simpler, students are still â€Å"challenged by the need to infer and decipher a variety of literary devices† (Constantino). Another positive factor in graphic novels is how visual it is. Children today are becoming much more visual learners. This is probably due to the prevalence of television and computers in today’s society. While, television and computers have often been looked at as negative impacts in children’s learning, many students have figured out that there are good things on television and the internet. Also, these students have found out that there are books that are not particularly good, despite what they have been taught. While there is still going to be those people out there who will have their doubts about allowing this genre in education, students would benefit from having more visual learning and less long narratives in class, which is just what graphic novels would bring. One of the most important abilities for a student when reading is learning how to make inferences. Many times in comics and graphic novels, the author will give a â€Å"bare outline† of what is going on, and leave the reader to â€Å"fill in the blanks† with the scenery or facial expressions of the characters (Walter). This ability is key to not only reading, but also in daily life. Inferences often need to be made in conversation to know exactly what situation that person is going through. If graphic novels were added to more school’s curriculum, then not only would students’ reading abilities improve, but their conversational skills would also improve. The reader of comics must also be able to decode the messages that the writer displays in his work. No matter how discrete of a message the author may insert into a work, the reader must be able to put together the pieces of the puzzle to create a continuous story. The reader must perform closure in between the â€Å"encapsulated moments in order to create a completed whole out of fragments† (Duncan and Smith 12). This closure that the reader must make is very similar to making inferences. To do both, one must apply background knowledge and relate events that may be described indirectly to blend these sequences into a constant story. Because of the important skill of making inferences that is necessary to read and understand graphic novels, they can be used as a gateway to reading more challenging works by developing this skill in children. As was mentioned previously, children are relying more and more on learning through visual techniques. Because of that, comics can be much more helpful than long narratives in teaching students to understand imagery, tone, symbolism, and many others. One example of how visual aids can help students learn is by using facial expression or body language of the drawn characters in graphic novels. Students will be able to gain many details of the story by simply looking at these two things. By looking at a character’s facial expression, one can learn the current mood of the story, along with what tone the character may be using. Teaching students to look at these things will not just help them when reading a graphic novel, it can also help them figure out certain situations that may occur during their lives. While some people argue that graphic novels are much simpler or not as mentally stimulating, they do share some characteristics with text-based narratives. One characteristic in particular is that they both use onomatopoeia. While these text-based narratives will insert these words into a sentence, graphic novels will make an entire panel out of one of these words. Although both of these genres do use onomatopoeia equally as much, the usage in graphic novels is more imaginative. In graphic novels, the word is usually brought to the center of the page, and made colorful and exciting. Because of the way that graphic novels display this literary technique, students can easier realize when that literary device is being used. Students can get a better understanding of when this literary device is applicable, and that will make them more confident as they continue reading. Despite the fact that graphic novels can often maintain a simpler vocabulary, they can still teach students simple literary devices like onomatopoeia. While the vocabulary is usually simpler, the material is more complex. As Linda Starr states in her article, an advantage of using graphic novels in the classroom is that these books â€Å"present complex material in readable text†. This gives graphic novels an advantage over other, harder to read, novels because more often than not, these students have a greater understanding of issues that are dealt with in books, but not all the time can they decipher what the issues are because of the more difficult vocabulary. One way to simplify things for these students, while still challenging them mentally is to provide more graphic novels in the curriculum. There is always going to be crowds of people who will deny graphic novels ever being relevant in education, but the different ways students are learning, the way students must make inferences, and the visual techniques that are displayed in graphic novels all provide reasons why these texts should be included in the classroom today. Graphic novels can serve as a spring into a lifelong love of reading or it can simply keep the student interested enough to get through an assignment. Whatever a student’s level of reading skill, there is no doubt that they will be able to read a graphic novel, while still maintaining a certain complexity in the ideas presented. Graphic novels can also teach students how to make inferences, as well as recognize and understand common literary techniques. Above all, students’ imaginations, and possibly interests will rise because of this genre being implemented into a curriculum. As Jesse Karp notes about graphic novels, â€Å"the form reaches young people in a way no other can†, and that is what is most important to future students’ learning. Works Cited Constantino, Correne. â€Å"Teaching English and Reading with Graphic Novels†. Education. cu-portland. edu. Concordia University, n. d. Web. 3 May 2013. Randy Duncan and Matthew J. Smith. The Power of Comics: History, Form and Culture. New York: The Continuum International Publishing Group, 2009. Print. Karp, Jesse. â€Å"The Case for Graphic Novels in Education†. Americanlibrariesmagazine. org. Chicago: American Library Associarion, 1 Aug. 2011. Web. 3 May 2013. Starr, Linda. â€Å"Eek! Comics in the Classroom! †. Educationworld. com. Education World, 11 Jan. 2008. Web. 3 May 2013. Walter, Carlene. â€Å"Graphic Novels†. Eclection. wikispaces. com. Tangient LLC, n. d. Web. 3 May 2013.

Encoding RIP from Elaeis Guaneensis Jacq

Encoding RIP from Elaeis Guaneensis Jacq Detection and expression profiling of two novel transcripts encoding RIP from Elaeis guaneensis Jacq. in Ganoderma boninense interaction 1. Introduction Among several oil-producing plants, oil palm (Elaeis guineensis) is a tropical crop which is exclusively grown for oil production. Its high oil yield is extracted from oil palm’s thick fleshy mesocarp which is extremely rich in oil (80% of dry mass). Furthermore, oil palm has the highest oil production (oil per unit land) compared to other oil-producing plants. The extracted oil has been used widely for several applications including, food, cosmetics, and bio-fuel (Paterson 2007; Murphy 2009; Alizadeh et al. 2013). Among various diseases , the basal stem rot (BSR) is known to be the most serious disease in oil palm (Ho and Nawawi 1985). Furthermore, the BSR is caused by Ganoderma boninense which is considered specifically as a â€Å"white rot fungus†. The lignin is broken by the fungus leaving whitish cellulose exposed (Paterson 2007). The infection process is initiated when the oil palm roots are penetrated by fungal mycelia, which is spread out to the stem bole, after which the trunk eventually collapses (Rees et al. 2009). Malaysia and Indonesia have suffered the most severe losses from the BSR; furthermore, the diseases has been identified in Malaysia several decades ago (Ho and Nawawi 1985; Idris et al. 2004; Rees et al. 2007). Oil palms of different genetic origins have shown to have resistance to BSR. However, the genes involved in the resistance of oil palms against G. Boninense were unknown (Idris et al. 2004; Durand-Gasselin et al. 2005). Recently, few defence related genes were identified in oil palm. The major pathogen on oil palm in Malaysia has been identified as G. boninense Pat. Stem rots of oil palm caused by species of Ganoderma are a major threat to the sustainability of the oil palm production. In this study, we have isolated one cDNA encoding RIP’s EST, from oil palm. Its expression in oil palm root infected by G. boninese; was investigated to shed light on its potential involvement during early disease development. 2. Materials and methods 2.1 Sample preparation A total of 24 six-month-old oil palm seedlings (Elaeis guineensis Jacq., DxP, GH500 series) were purchased from Sime Darby Plantation Sdn. Bhd. (Banting Malaysia) and divided into two groups with 12 seedlings in each group, one of these groups were treated with Ganoderma boninense Pat. Strain PER71, while the remaining group served as controls. Seedlings treated with G.boninense were inoculated by sitting each seedling on rubber woodblock fully grown with G.boninense PER71 while the other group of seedlings were inoculated with fungal surface mulch as described by (Alizadeh et al., 2011). Three biological replicates of the seedlings were harvested from each treatment at 4, 8, 12 wpi, respectively. The leaves, roots and stem cell were frozen in liquid nitrogen and stored at -80 °C (Tan et al., 2013). 2.2 RNA extraction Total RNA was extracted from treated and untreated oil palm root tissues using a modified CTAB method briefly, 0.1 g tissue was ground in liquid nitrogen into a very find powder. The powder was immediately transferred into 1.5 ml extraction CTAB buffer [ 2% (w/v) cetyl trimethyl ammonium bromide, CTAB; 100mM Tris-HCl, pH 8.0; 2M NaCl; 25 mM ethylenediamineteraacetic acid, EDTA; pH 8.0; 2% (w/v) polyvinylpyrrolidone, PVP; and 2% (v/v) ÃŽ ²-mercaptoethanool]. Equal volume of chloroform/isoamylalcohol (24:1, v/v) was added into the tube and centrifuged at 12,857 g for 15 min at 4 °C. The upper layer was transferred into a new tube and equal volume of phenol/chloroform/isoamylalcohol (25:24:1, v/v/v) was added and centrifuged. This step was repeated until a clear supernatant was obtained. The supernatant was adjusted to a final concentration of 2M LiCl, and incubated at 4 °C for overnight, and then centrifuged. The RNA was dissolved in 5ml diethypyrocarbonate (DEPC) – treated water. An equal volume of chloroform/isoamylalcohol was added, mixed, and centrifuged at 12,857 for 30 min at 4 °C. Precipitation of RNA was performed by adding 0.1 vol of 3M sodium acetate (pH 5.2), 2 vol 100% ethanol and incubated at -80 °C for overnight. After centrifugation, the pellet was washed using 70% ethanol and dissolved in 20ul DEPC-treated water. The quality of RNA was examined by using a Nanodrop( BioRad) at 230, 260 and 280 nm. The RNA integrity was examined using 1.5% agarose gel electrophoresis. The RNA was treated with DNase I (Qiagen, USA) following the manufacturer’s instructions. Figure : Total RNA from various treated and untreated oil palm tissues. Lane A: Untreated control seedling. Lane B: Treated seedlings. 1) Leaf. 2) Basal stem. 3) Root 3. Semi-quantitative Reverse transcriptase (RT-) PCR 3.1 Isolation of cDNA Omniscript â„ ¢ Reverse Transcriptase kit (Qiagen Kit) was used for cDNA synthesis by the following kit manuscript. To obtain the sequence of cDNA from oil palm, gene specific primers were designed based on oil palm expressed sequence tag (EST) (Ho, 2010) and RIP’s type I alignments, using primer 3 version 0.4.0(frodo.wi.mit.edu). 3.2 Sequence analysis of cDNA Semi-quantitative Reverse transcriptase (RT-) PCR was performed on EST using PCR machine with Reverse transcriptase enzyme. Equal amounts of RNA (1ug) extracted from control and treated oil palm root samples were converted into cDNA by using the Omniscript two step Reverse Transcription Kit for cDNA Synthesis (Qiagen, USA) following the manufacturer’s instructions. The resulted sequences shown significant similarities to RIP (Naher et al., 2011). 3.3 Expression profiling Expression levels were calculated by Quantity One 1-D Analysis software 4.6.5 (Bio-Rad) according to the manufacturer’s instructions. PCR products were resolved on 1.5%(w/v) agarose gel (1xTAE) with a DNA mass standard marker (MassRuler TM DNA Ladder, Fermentas). The density of the DNA mass standard dilution series was used to generate calibration curve for absolute quantisation of sample bands by linear regression with extrapolation to zero for each experiment. The density of each sample band was then converted to an absolute quantity using the calibration curve. For each sample band was then converted to an absolute quantity using the calibration curve. For each experiment, the relative band quantity obtained by densitometrric analysis was normalized to the value of the internal control (house-keeping gene) bands which were run in parallel. Identification of differentially expressed genes was based on consistent ford-change across experimental replicates relative to untreate d negative control. Fold changes of ≠¥2- fold or ≠¤0.5-fold were considered as significant. 3.4 Statistical analysis A one-way analysis of variance (ANOVA) was used to determine statistical differences (SPSS version 17;SPSS Inc., Chicago, IL). When the ANOVA was significant at P 0.05 the Duncan’s multiple range test was used for means comparison. The t-test was used to compare between group means.(Alizadeh et al., 2011) 4. Results 4.1 sequence analysis EgRIP-1b The partial cDNA of EgRIP-1b (Dr. Ho personal comment) encodes a putative type I ribosome inactivating protein. The partial sequence consists 167 nucleotide residues. (Fig. 2). This sequence has the highest identity with RIP type I from Populus trichocarpa (98%, XP_002328056.1), Hordeum vulgare (90%, AAA32951.1) and Chain A, Structure Of Mutant Rip From Barley Seeds (90%, 4FBA_A). The NODE_77734GT was classified in a RIP-like superfamily. A putative conserved domain of catalytic residues and some RIP family domain were in this sequence, including that it is a member of the RIP superfamily.(Fig. 5) (Naher et al., 2011) M I C E S I R F E R I S E F L A T E F P G S S K P P K TGATGATCTGCGAGTCGATTAGATTCGAACGCATCTCCGAATTTCTTGCTACCGAATTCCCCGGCAGTTCGAAACCCCCTAAA W M P A L E H G W G D L S A A L L R A D A N P D R P F TGGATGCCGGCACTCGAGCACGGCTGGGGAGATCTCTTTGCCGCGTTGCTGCGCGCCGATGCCAATCCCGACCGTCCCTTCA Fig. 2. The nucleotide and deduced amino acid sequences of NODE_77734GT. 4.2 sequence analysis EgRIP-1a The partial cDNA sequence EgRIP-1a (GenBank ID: ) encodes a protein of 17 amino acid. The sequence consists 178 nucleotides (Fig. 3). This sequences has the highest identity with other type I RIPs from Nicotiana tabacum (47%, ABY71831.1), Musa acuminate (47%, ABY71832.1), Alocasia macrorrhizos (47%, ABY71829.1), Agave sisalana (47%, ABY71828.1) (Fig. 6.a) and (Fig. 6.b) M R P T P N F H Y E W S A CAGGATTCCAGCCGAGCTCCTGCGATAGCCGAACTTCTACCACATGCGACCTACTCCAAACTTCCACTACGAGTGGTCTGCTC L S K Q TCTCCAAACAA Fig. 3. The nucleotide and deduced amino acid sequences of EgRIP-1a. Fig. 4: multiple alignment of NODE with other type I RIPs. Amino acid residues that are identical in all sequences are highlighted in black while amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. (a) (b) Fig. 5: Multiple alignment of EgRIP-1a with other RIPs. The protein sequences and their accession numbers used for analysis of detected sequence. a) Nucleotide residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. b) Amino acid residues that are identical in all sequences are highlighted in black with amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. 4.3 Expression profiles (of RIP) in oil palm root upon Ganoderma inoculation A total of 2 cDNA sequences encoding putative defence-related proteins from oil palm were chosen for gene expression profiling in this study. A relative semi-quantification of EgRIP-1b and EgRIP-1b transcripts were performed by calibrating the expression of each gene with an endogenous control, actin. Fig.6 Shows the relative expression level of EgRIP-1b in roots and basal stems in response to the inoculation of G. boninense at different time points compared with that of negative control plants. In G. boninense-treated plants, the gene expression of EgRIP-1b in oil palm roots at 2 wpi was induced. The expression level were n- and n-fold of the uninfected root tissues at 8 and 12 wpi, respectively.(Naher et al., 2011) The expression level was studied in 3 replication of each sample, there were no significant (P>0.05) differences in expression levels in inoculated plants (Alizadeh et al., 2011). EgRIP-1a was up-regulated n-fold and n-fold at X wpi, respectively; before the transcript level decrease at Y wpi in oil palm root tissue following G.boninense infection (Fig). EgRIP-1a expression level were m-, m- and m-fold of the uninfected basal stem tissues at 2,4, 8 and 12 wpi, respectively. EgRIP-1b and EgRIP-1a were not expressed in time zero, untreated samples and leaf tissues. (I) diseased (II) healthy (a) (b) (c) Fig. 6. Differential expression of EgRIP-1b in variety tissues in response to I) G.boninese treatment compare to those in II )control.. a) root tissue, b) stem cell tissue, c) standard (Rippmann et al., 1997) a) b) Fig. 7. Expression level mean in each biological replicate a) in root; b) in stem (I) diseased (II) healthy (a) (b) (c) Fig. 8. Differential expression of EgRIP-1a in variety tissues in response to I) G.boninese treatment compare to those in II) control.. a) root tissue, b) stem cell tissue, c) leaf tissue d)control (Rippmann et al., 1997) a) b) Fig. 9. Expression level mean in each biological replicate a) in root; b) in stem Fig. 10. Semi-quantification of oil palm EgRIP-1a and EgRIP-1b expression levels in root tissues at 2-12 week after inoculation with G.boninense. Significant up-regulation of gene expression compared to untreated negative control. References Alizadeh F, Abdullah SNA, Chong PP, Selamat A Bin (2013) Expression Analysis of Fatty Acid Biosynthetic Pathway Genes during Interactions of Oil Palm (Elaeis guineensis Jacq.) with the Pathogenic Ganoderma boninense and Symbiotic Trichoderma harzianum Fungal Organisms. Plant Molecular Biology Reporter. doi: 10.1007/s11105-013-0595-y Durand-Gasselin T, Asmady H, Flori a, et al. (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninenseprospects for future breeding. Mycopathologia 159:93–100. doi: 10.1007/s11046-004-4429-1 Ho YW, Nawawi A (1985) Ganoderma boninense Pat . from Basal Stem Rot of Oil Palm ( Elaeis guineensis ) in Peninsular Malaysia. Pertanika 8:425–428. Idris AS, Kushairi A, Ismail S, Ariffin D (2004) SELECTION FOR PARTIAL RESISTANCE IN OIL PALM PROGENIES TO Ganoderma BASAL STEM ROT. Journal of Oil Palm Research 16:12–18. Murphy DJ (2009) Oil palm: future prospects for yield and quality improvements. Lipid Technology 21:257–260. doi: 10.1002/lite.200900067 Paterson R (2007) Ganoderma disease of oil palm—A white rot perspective necessary for integrated control. Crop Protection. doi: 10.1016/j.cropro.2006.11.009 pilotti CA (2005) Stem rots of oil palm caused by Ganoderma boninense: Pathogen biology and epidemiology. Mycopathologia 159:129–137. Rees RW, Flood J, Hasan Y, et al. (2009) Basal stem rot of oil palm ( Elaeis guineensis ); mode of root infection and lower stem invasion by Ganoderma boninense. Plant Pathology 58:982–989. doi: 10.1111/j.1365-3059.2009.02100.x Rees RW, Flood J, Hasan Y, Cooper RM (2007) Effects of inoculum potential, shading and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathology. doi: 10.1111/j.1365-3059.2007.01621.x Tan Y-C, Yeoh K-A, Wong M-Y, Ho C-L (2013) Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense. Journal of plant physiology. doi: 10.1016/j.jplph.2013.05.009

Language in Wilfred Owens The Sentry :: essays research papers

Wilfred Owen’s ‘The Sentry’ To me Wilfred Owen’s poetry is visually descriptive, so much so that he seems to be able to effortlessly transport you into whatever situation he is describing. This particular poem leaves you in no doubt as to the horrors of war and the terrible atrocities these poor men endured. In the opening line he says ‘and he knew’ using the technique of personalisation he has turned the massive opposing force into a single person, someone who was actively trying to single them out, to attack them personally. This shows you just how desperate they felt and how to them no matter where they seemed to find shelter ‘he’ was never far behind. He goes on to say ‘and gave us hell for shell on frantic shell hammered on top, but never quite got through’. By using the word ‘hell’ he is actively describing the terrible endlessness of their situation or the perseverance of the enemy and the fact that they cannot escape. enduring the onslaught, hour on hour, day by day. ‘Frantic shell’ the word frantic to me describes the non-target based shelling, as the enemy knew they that their enemy was somewhere in front of them, so just seemed to shell anywhere within that vicinity in the sure hope that they would be causing death eventually. The use of the rhyming words ‘hell’ and ‘shell’ automatically connects the two words in the reader’s brain, forming a connection and reinforcing the idea of the battle being ‘hell’. ‘Hammered’is also a very thought provoking verb used in this line, this word used in this particular sentence is brilliant, it not only describes the noise, as you cannot hammer quietly, but describes the repetition, when hammering something you repeatedly strike it. Hammered is a violent verb and its two syllables makes the word sound short and harsh. In the following line, ‘rain, guttering down’ this makes me think the guttering I have on my house, a purpose made moulded channel used to transport water. He deliberately used this word to convey just how much rain had fallen that it had naturally moulded gutters out of the mud, channelling the slime and slurry into waterfalls. There is also assonance in this sentence emphasising the guttering (which I have already analysed above). Wilfred Owen is cleverly able to relate to you a description of a bomb without ever actually calling it a bomb.

Margins: Meaning of Life and Frazier Essay

In Ian Frazier’s essay, â€Å"In Praise of Margins†, the author talks about his childhood life and how he had â€Å"margins† where he and his friends would do things and nothing would matter because they wouldn’t care. â€Å"Marginal† thought is valuable because it allows adults to use their imagination. His purpose is to try new activities without shame; it’s the spur of the moment that defines margin. I think his view about marginal activity is comprehensive and relatable. When we think of margins, we think of the extra space on the edge of the paper that we can’t write out of. But marginal has another meaning to it which has to do with the economic world and how we function with margins in our life such as personal experiences. Marginal space is key to the coming of age process in each person’s life whether we share the same activities or not. Although it’s not easy to pin point it out but marginal spaces are needed to escape from everyone’s present problem in everyday life. I agree and believe with Frazier when he is talking about the meaning of marginal because it is true that margins sometimes do not come out the way you want it to be, nothing or nobody is perfect and there are always something ruining the perfect moment that we all have or want. Marginal act take such a high valued meaning according to Frazier because the places and activities that he discovered through his childhood is something that has been lost in the past and also in many societies, especially the economic society. According to Frazier, he added, â€Å"†¦the margin is where you can try out ideas that you might be afraid to admit to with people looking on. † (7) This is an important concept to anyone’s life. One person’s marginal space can different from another person’s as long as it is an activity in which the person escapes from reality. In an economic society, time is considered money and Frazier’s activity of sitting on a tree for hours is more on the lines of suicidal, in economic society’s terms. Frazier agreed that he felt useless at the time of just sitting but as he grew older, the useless time of gazing off turned into something sacred towards him. The sitting in the tree gave him memories and something to reflect back on. It came upon me when I took my nephews out to the ice rink at the Christmas in the Park; I realized if I never done this I would have missed out on what defined me as of today. Though it’s all fun and games I know that it’s one of the activities you can do once in a while that can take you away from your stress and busy day life-style. Reflection cannot happen when there is nothing to look back on. There are always memories that others have whether it be good or bad. It might be their first time driving or their first time swimming. Any memory is something someone can reflect back onto to see who they are and to see how they got to the place they are now. The economic society always keeps moving on and thinks about the future, while human beings need time to focus and reminisce from where they came from. If someone keeps running straight with their heads down, they might get far but eventually, they will get lost. In order to stay on track and know where you’re heading, at times the person needs to look back to see where they started from. Know where you are is the most important thing to knowing who you are and Frazier realized the great importance of that. Frazier’s useless â€Å"marginal† activity such as just plainly sitting brought out the importance of just doing things not to gain a profit but to gain something to reflect on. When Frazier was younger, he had his own marginal place and would always go out to â€Å"the woods†; it was his â€Å"part-time address, destination, purpose, and excuse† (1). While Frazier ran around bumping into bushes and branches, slipping and sliding through thick brown dirt; I was ice skating at the ice arena, hop-scotching, and playing house. Throughout my childhood, I dedicated numerous hours in the freezing cold ice arena at the local mall, hop-scotched afterschool with my neighbors, and played house on the weekends with my cousins. These activities may sound typical as a child but it had a significant meaning towards me. It was my purpose to grow upon these marginal experiences. In the end, all that matters is being able to free your mind from something that you free yourself from caring about what others think. And I believe that I accomplish my marginal activity as a child, through every fall and bruises that I received while ice skating, I couldn’t care less about what others had to say about me because I knew that every time I got up it’ll only make me a better skater in the end. Although changes occurred and I grew out of the marginal acts, agreeing with Frazier’s realization, â€Å"†¦and suddenly there was nothing up there for us. † (4) The excitement of skating on the slipping cold ice with no shame of failing can only be done as a marginal act, because I can no longer look at the rink the same way I did when I was younger. Nor can I play hop-scotch the way I did, hopping from one box to another is like going from one class to another today. Instead of playing house with my cousins, we became college students looking for a stable job that can support our education. I agree with Frazier that the â€Å"remember whens† really does faltered and â€Å"playing† time doesn’t have to end here. Although margins can be done differently and looked at differently, marginal is necessary for a person of all ages to let loose in order to overcome the pressure and stresses of everyday life. Frazier’s marginal activities consisted of breaking ice, climbing trees, and picking fruits. My marginal activities consisted of ice skating, hop-scotching, and playing house. Marginal activities may vary from being active in a sport, traveling, singing or perhaps even enjoying a movie night on the couch; by the end of the day marginal activities is necessary in order to free yourself from the strains of everyday life.

Long-term Negative Effect of Breatharianism

A reason behind I became a breatharian is to maintain a slim figure, living healthy, and happy. Unfortunately, any of those my wish doesn’t come true. That’s why I decided to inform the vice squad for further investigation into the organization. The breatharian diet neither includes food nor water. However, after seeing several YouTube video and commercial on flyer, I was convinced by the specious way to live life. Once I enrolled, I came to know many things, for example, some of the main people of the organization not even follow their own instruction which is not to eat or drink. I would like to share my personal experience and that is I am completely unsatisfied with diet plan and even their promises. They said to me that, â€Å"if you live only on light and air, you became healthier and happier more than you are right now. † Nevertheless, just following there instruction I became ill. I had to visit an emergency room of hospital twice a month. Now, I am suffering from high blood pressure. That’s just my experience. One of my friends also enrolled in this program and she is suffering from renal disease. I want to submit this report against the organization, because I feel their only purpose is to make money out of people like us. They are making this money by enrolment and seminar fees. In addition to that, after one month experience of being part of their program, I feel that they not follow their own instruction. I saw one of them eating outside the Taco Bell. The diet plans they provide are dangerous and lead many lives in danger. After all it’s our moral duty to save local citizen. It’s my humble request to take a step towards the organization.

Cross Culture

Introduction: Introduction Communication is the process by which information is transmitted between individuals and/or organizations so that an understanding response results. Simply we can say, Communication is an exchange of facts, ideas, opinions or emotions by two or more person. The transmission of the sender’s ideas to the receiver and the receiver’s feedback or reaction to the sender constitute the communication cycle. SENDERRECEIVER InputOutput [pic] Feedback Brain drain Brain drain Brain drain Fig- 01: Communication Cycle Culture is an idea in the field of management which describes the psychology, attitudes, experiences, beliefs and values (personal and cultural values) of an organization. Culture is a complex concept. In other words, culture is central to what we see, how we make sense of what we see, and how we express ourselves. Objective of the Report: The Primary Objective of this report is to analysis of cross cultural communication in IBM. The report has accumulated information to know about company’s cross cultural communication, to find out its positive and productive communication in their organization and does the work effectively. Methodology: Sources of data: †¢ Secondary Data: All the data and information are collected from secondary sources. Cross-Cultural Communication: The success of a business depends on its ability to communicate. Communication serves as the medium for instruction, assessment, interpersonal relationships, group interactions and all other interaction that takes place in business. With globalization, business is no longer constrained within the boundaries of a single country. Large business organizations have corporate offices in different parts of the world. They need to communicate in order to promote coordination. Also in multinational companies people from different parts of the world are employed. The way an individual communicates, is influenced by his or her culture. Hence in today’s increasing global economy, it is important for managers and employees at all levels to understand, appreciate, and manage the impact of cross-cultural communication in the workplace. As our world grows, expands and becomes increasingly more interconnected by various technological advances, the need for effective communication among various cultures is increasing. People from different backgrounds tend to perceive information differently. Hence, misinterpretation of information can lead to conflict. Cross cultural communication is of great importance through out the world. Though in our country, due to the lack of cultural diversity, cross cultural communication is not treated with that much importance. But still with the advancement of technology we have to interact with businesspeople in faraway countries and for this we need know about effective techniques of cross cultural communication Definition of Cross-Cultural Communication: To understand cross cultural communication first we need to know what culture is. Culture refers to a group or community with which we share common experiences that shape the way we understand the world. Cross-cultural communication looks at how people, from differing cultural backgrounds, endeavor to communicate. It is more frequently referred to as Intercultural communication. (Ramsey, 1999). Culture refers to all the knowledge and values shared by a society. The word culture is often considered in terms of nationality or one's country of origin. Other more specific distinguishing characteristics of culture are region, orientation, socioeconomic status, gender, sexual orientation and preference, age, marital and parental status. Another approach to understanding the concept of culture involves the beliefs, values and norms that exist to guide an individual's behaviors in solving common problems. Culture is the acquired knowledge people use to interpret experience and generate behavior (Porter, 1991). Culture is the shared customs, beliefs, and social structures that make up a society, including languages, rules, myths, family patterns, and political systems. (Boone et al. 1997). Cross cultural communication is a symbolic, interpretive, transactional, contextual processing tool with which people from different cultures create shared meanings (Berko et al. , 1997). When we speak to someone with whom we share little or no cultural bond, it is referred to as cross cultural communication. Our need to communicate across culture can be very beneficial personally and professionally. Within an intercultural setting, nonverbal and verbal communications are both prevalent in emphasizing the differences in cultures. The way we act and the things we say determine whether or not we belong in a certain culture. Nonverbal communication systems provide information about the meaning associated with the use of space, time, touch and gestures. They help to define the boundaries between the members and nonmembers of a culture (Hofstede, 1991). Hence, Cross Cultural Communication is the communication that takes place among people from different cultures. Cross cultural communication does not only mean face to face communication it includes all forms of written and oral communication. History of Cross-Cultural Communication: The need for Cross-Cultural communication was felt with the spread of global commerce. It is very tough to get the specific date when cross-cultural communication started. Initial initiatives in cross-cultural communication were taken in different countries in different time period. One of the pioneers of the computer industry, IBM started cross cultural communication in 1953. It was introduced by the CEO of that time Thomas J. Watson Jnr. According to Thomas it was the policy of IBM to hire talented people regardless of race, color and background. During 1978-83, the Dutch cultural anthropologist Geert Hofstede conducted detailed interviews with hundreds of IBM employees in 53 countries. Through standard statistical analysis of fairly large data sets, he was able to determine patterns of similarities and differences among the replies. In the year 1991, Geert Hofstede undertook the first global studies on how a specific business culture, at the time one of the most widely distributed companies, interacted with the local cultures of some 39 different countries. Another professional development initiative is IBM’s Shade of blues – a more in-depth program for managers who are engaged in cross-cultural business interactions or have multicultural teams. Recent Research on Cross-Cultural Communication: As people from different cultural groups take on the exciting challenge of working together, cultural values sometimes conflict. We can misunderstand each other, and react in ways that can hinder what are otherwise promising partnerships. Oftentimes, we aren't aware that culture is acting upon us. Sometimes, we are not even aware that we have cultural values or assumptions that are different from others. One of the major barriers in business communication is cultural diversity. Many communication researchers are trying to find out new and effective ways to improve cross cultural communication. In many cases patients face problems with both translation difficulties and not being able to see the type clearly. As a result they are sometimes unable to take their prescriptions correctly. Many of the pharmaceuticals around the world have been trying to solve this problem. Recently they have come up with a tool which can print instructions for taking medicine in 11 different languages on the prescription bottle labels. Patients no longer have to depend on translation from a friend or relative to make sure they are taking their prescriptions correctly. The languages include English, Spanish, French, Arabic, Korean, Chinese, Japanese, Hindi, Polish, Russian or Portuguese. The tool is also equipped to print a 20- point type versus the typical smaller type, for those patients who prefer larger printed labels on the bottle labels to easily identify their medicines and how to take them. On July 6, 2005 Mark Nash, an American entrepreneur created a cross-cultural website created especially for non-resident Indians and offshore call center personnel (Nash, 2005). The website www. intro2america. om was designed to provide information about American culture. It was also designed to provide information to call center personnel who speak with Americans on a daily basis as part of their job responsibilities. The site is designed to make the transition to American lifestyle easier and reduce the difficulties & misunderstandings upon first moving to the States. The site provides useful information, which is related specifically to cross-cultural types of issues. Moving from an Asian culture to a Western culture can be challenging. The site was designed for the specific purpose of easing the transition to American way of life, for those who are moving to the United States (See Appendix for the sample of the website). To serve customers from diversified cultures, they have taken a great deal of effort and time to analyze what their customers around the globe want. To achieve this they are trying to understand their customer’s behavior, cultural and spending patterns when they fly with Malaysia Airlines. The airliner has successfully catered to the demands of wide variety global customers around the world. Application in the work place: IBM, the leading business organization in computer sector, has a huge diverse workforce from the very beginning. They have concentration to manage the cross cultural communication among these employees. Here we have selected IBM’s Australia branch to present as an example of cross cultural environment where employees are working together with their cultural differences. IBM has developed their cross-cultural program based on the legal requirements of Anti- Discrimination Act & Racial Discrimination Act and corporate values. IBM’s policies on cultural diversity are based on years of corporate experience. It is a long-held view that by valuing diversity, it uncovers new perspectives, taps different knowledge and experience and generates innovative ideas, suggestions and methods. Three pillars that are in place to make up IBM’s diversity strategy are: †¢ Creating a work/life balance: Their strategy is to find the average working age of general Australians through statistical findings and fix age limit for average Australians. †¢ Advancement of women: They think women should contribute more to the workplace. So, they encourage participation of women. †¢ Integration of people with a disability: IBM authority thinks that they have a social responsibility for physically and mentally disable people. The authority always tries to create some opportunity of employment for those people. IBM’s most effective diversity programs combine ‘push and pull’ strategies. They have made good headway through company-led, top down practices such as formalized training or policies like floating cultural holidays. However, IBM’s progress comes about through the contributions by individuals who are passionate about diversity issue. Aside from IBM’s diversity team within human resources, three other groups within IBM have formally identified roles in the implementation of the company’s overall diversity strategy. These are IBM’s Diversity Council, diversity contact officers and diversity champions. The Diversity Council The main objective of the IBM’s Diversity Council, is to ensure that the contribution of employees from different background is properly encouraged and valued. Its key objectives are to enhance employee awareness, increase management awareness, and encourage the effective use of IBM’s diverse workforce. This is achieved through personal commitment, regular communication, by gaining support for the program from other IBM managers and influencing decision making. Under the guidance of the Diversity Council, a series of cultural diversity employee roundtables have been held to gather more face-to-face feedback and ideas from staff. These meetings have generated many practical ideas for increasing awareness of cultural diversity within IBM. Professional development IBM has a professional development program. The objective of this program is to ensure that the employees within the organization can identify and remove psychological barriers of diverse workforce and communicate effectively. The main focuses of this program are: †¢ Understanding the cultural bias of each team member and their impact on mutualperceptions. †¢ Determine the reasons why certain behaviors and communication styles fail in somecultures. †¢ Identifying approaches to address cultural gaps that could lead to misunderstandings. †¢ Handling issues about team decision-making, giving or receiving feedback and conflict resolution. Findings: IBM, One of the pioneers of the computer industry started cross cultural communication in 1953. †¢ They think women should contribute more to the workplace. So, they encourage participation of women. †¢ IBM authority thinks that they have a social responsibility for physically and mentally disable people. The authority always tries to create some opportunit y of employment for thosepeople. Recommendations: Considering research and the case of IBM, we have some recommendation here which will decrease discrimination and increase production by making the flow of cross-cultural communication fluent. Those recommendations are as follows: ? IBM should compare their policy for cross cultural communication with others, so that they can get some new ideas to implement in their organization. It will help them to update existing policies as well. ? Not only the HR department of IBM, but also all other employees of the organization should be involved in the process of making cross cultural communication easier. It will help the whole organization to become a good team. ? Training and raising awareness can improve mentality of the employees towards others. They will learn to respect and honor others differences. Place people from different cultures as team leaders. If diverse employees get opportunity to work and share success they will be highly motivated. Discrimination will be dissolved from them and the communication process will work freely. ? A good idea can be to focus different segments one after another so that every segment can achieve expected mentality. This process will form unity and emotion among the employees of the organization. Discrimination will be terminated and the total organization will work as one body. ? Each program introduced in the organization should honor the basic values of the organization. Every program should ensure that none of the employees are discriminated in terms of race, national origin or religion. Conclusion: From the above research we have seen that cultural communication plays a vital role for effective communication for companies around the globe. In our country due to the lack of cultural diversity we do not have to face the problems related to intercultural communication. Many of the successful companies having corporate offices have been able to coordinate their activities through out the world through the successful implementation of cross cultural communication. One of the fore runners in this sector is definitely IBM. IBM has independent division to come up with new policies and strategies to improve cross cultural communication in the workplace. Reference: Boone, L. E. , Kurtz, D. L. , & Block, Judy R. (1997). Contemporary Business Communication (2nd ed. ). Upper Saddle River, New Jersey: Prentince-Hall. 67. Ramsey, James (1999). Available: http://encyclopedia. localcolorart. com/encyclopedia/Cross-cultural_communication/ (July, 17 2005). Carbaugh, D, (1990). Cultural Communication and Intercultural Contact. New York: Pergamon Press. 19. Berko, R. , Rosengeld, L. , & Samovar, L. (1997). Connecting: A Culture Sensitive Approach to Intercultural Communication. Fort Worth, Texas: Harcourt Brace. 121. Porter, R. , and Samovar, L. (1991). Communication Between Cultures. Belmont:NTC Publishing Group. 273. Payne, C. (2001). Culture and Communication. Available: http://www2. mhc. ab. ca/users/cpayne/portfolio/cultcomm/default. htm (July, 29 2005). Appendix [pic] A sample website dedicated to understanding cross-cultural types of issues. [pic] ———————– Idea Letter, Fax, Phone call, E-mail etc. Idea Cross Culture Introduction: Introduction Communication is the process by which information is transmitted between individuals and/or organizations so that an understanding response results. Simply we can say, Communication is an exchange of facts, ideas, opinions or emotions by two or more person. The transmission of the sender’s ideas to the receiver and the receiver’s feedback or reaction to the sender constitute the communication cycle. SENDERRECEIVER InputOutput [pic] Feedback Brain drain Brain drain Brain drain Fig- 01: Communication Cycle Culture is an idea in the field of management which describes the psychology, attitudes, experiences, beliefs and values (personal and cultural values) of an organization. Culture is a complex concept. In other words, culture is central to what we see, how we make sense of what we see, and how we express ourselves. Objective of the Report: The Primary Objective of this report is to analysis of cross cultural communication in IBM. The report has accumulated information to know about company’s cross cultural communication, to find out its positive and productive communication in their organization and does the work effectively. Methodology: Sources of data: †¢ Secondary Data: All the data and information are collected from secondary sources. Cross-Cultural Communication: The success of a business depends on its ability to communicate. Communication serves as the medium for instruction, assessment, interpersonal relationships, group interactions and all other interaction that takes place in business. With globalization, business is no longer constrained within the boundaries of a single country. Large business organizations have corporate offices in different parts of the world. They need to communicate in order to promote coordination. Also in multinational companies people from different parts of the world are employed. The way an individual communicates, is influenced by his or her culture. Hence in today’s increasing global economy, it is important for managers and employees at all levels to understand, appreciate, and manage the impact of cross-cultural communication in the workplace. As our world grows, expands and becomes increasingly more interconnected by various technological advances, the need for effective communication among various cultures is increasing. People from different backgrounds tend to perceive information differently. Hence, misinterpretation of information can lead to conflict. Cross cultural communication is of great importance through out the world. Though in our country, due to the lack of cultural diversity, cross cultural communication is not treated with that much importance. But still with the advancement of technology we have to interact with businesspeople in faraway countries and for this we need know about effective techniques of cross cultural communication Definition of Cross-Cultural Communication: To understand cross cultural communication first we need to know what culture is. Culture refers to a group or community with which we share common experiences that shape the way we understand the world. Cross-cultural communication looks at how people, from differing cultural backgrounds, endeavor to communicate. It is more frequently referred to as Intercultural communication. (Ramsey, 1999). Culture refers to all the knowledge and values shared by a society. The word culture is often considered in terms of nationality or one's country of origin. Other more specific distinguishing characteristics of culture are region, orientation, socioeconomic status, gender, sexual orientation and preference, age, marital and parental status. Another approach to understanding the concept of culture involves the beliefs, values and norms that exist to guide an individual's behaviors in solving common problems. Culture is the acquired knowledge people use to interpret experience and generate behavior (Porter, 1991). Culture is the shared customs, beliefs, and social structures that make up a society, including languages, rules, myths, family patterns, and political systems. (Boone et al. 1997). Cross cultural communication is a symbolic, interpretive, transactional, contextual processing tool with which people from different cultures create shared meanings (Berko et al. , 1997). When we speak to someone with whom we share little or no cultural bond, it is referred to as cross cultural communication. Our need to communicate across culture can be very beneficial personally and professionally. Within an intercultural setting, nonverbal and verbal communications are both prevalent in emphasizing the differences in cultures. The way we act and the things we say determine whether or not we belong in a certain culture. Nonverbal communication systems provide information about the meaning associated with the use of space, time, touch and gestures. They help to define the boundaries between the members and nonmembers of a culture (Hofstede, 1991). Hence, Cross Cultural Communication is the communication that takes place among people from different cultures. Cross cultural communication does not only mean face to face communication it includes all forms of written and oral communication. History of Cross-Cultural Communication: The need for Cross-Cultural communication was felt with the spread of global commerce. It is very tough to get the specific date when cross-cultural communication started. Initial initiatives in cross-cultural communication were taken in different countries in different time period. One of the pioneers of the computer industry, IBM started cross cultural communication in 1953. It was introduced by the CEO of that time Thomas J. Watson Jnr. According to Thomas it was the policy of IBM to hire talented people regardless of race, color and background. During 1978-83, the Dutch cultural anthropologist Geert Hofstede conducted detailed interviews with hundreds of IBM employees in 53 countries. Through standard statistical analysis of fairly large data sets, he was able to determine patterns of similarities and differences among the replies. In the year 1991, Geert Hofstede undertook the first global studies on how a specific business culture, at the time one of the most widely distributed companies, interacted with the local cultures of some 39 different countries. Another professional development initiative is IBM’s Shade of blues – a more in-depth program for managers who are engaged in cross-cultural business interactions or have multicultural teams. Recent Research on Cross-Cultural Communication: As people from different cultural groups take on the exciting challenge of working together, cultural values sometimes conflict. We can misunderstand each other, and react in ways that can hinder what are otherwise promising partnerships. Oftentimes, we aren't aware that culture is acting upon us. Sometimes, we are not even aware that we have cultural values or assumptions that are different from others. One of the major barriers in business communication is cultural diversity. Many communication researchers are trying to find out new and effective ways to improve cross cultural communication. In many cases patients face problems with both translation difficulties and not being able to see the type clearly. As a result they are sometimes unable to take their prescriptions correctly. Many of the pharmaceuticals around the world have been trying to solve this problem. Recently they have come up with a tool which can print instructions for taking medicine in 11 different languages on the prescription bottle labels. Patients no longer have to depend on translation from a friend or relative to make sure they are taking their prescriptions correctly. The languages include English, Spanish, French, Arabic, Korean, Chinese, Japanese, Hindi, Polish, Russian or Portuguese. The tool is also equipped to print a 20- point type versus the typical smaller type, for those patients who prefer larger printed labels on the bottle labels to easily identify their medicines and how to take them. On July 6, 2005 Mark Nash, an American entrepreneur created a cross-cultural website created especially for non-resident Indians and offshore call center personnel (Nash, 2005). The website www. intro2america. om was designed to provide information about American culture. It was also designed to provide information to call center personnel who speak with Americans on a daily basis as part of their job responsibilities. The site is designed to make the transition to American lifestyle easier and reduce the difficulties & misunderstandings upon first moving to the States. The site provides useful information, which is related specifically to cross-cultural types of issues. Moving from an Asian culture to a Western culture can be challenging. The site was designed for the specific purpose of easing the transition to American way of life, for those who are moving to the United States (See Appendix for the sample of the website). To serve customers from diversified cultures, they have taken a great deal of effort and time to analyze what their customers around the globe want. To achieve this they are trying to understand their customer’s behavior, cultural and spending patterns when they fly with Malaysia Airlines. The airliner has successfully catered to the demands of wide variety global customers around the world. Application in the work place: IBM, the leading business organization in computer sector, has a huge diverse workforce from the very beginning. They have concentration to manage the cross cultural communication among these employees. Here we have selected IBM’s Australia branch to present as an example of cross cultural environment where employees are working together with their cultural differences. IBM has developed their cross-cultural program based on the legal requirements of Anti- Discrimination Act & Racial Discrimination Act and corporate values. IBM’s policies on cultural diversity are based on years of corporate experience. It is a long-held view that by valuing diversity, it uncovers new perspectives, taps different knowledge and experience and generates innovative ideas, suggestions and methods. Three pillars that are in place to make up IBM’s diversity strategy are: †¢ Creating a work/life balance: Their strategy is to find the average working age of general Australians through statistical findings and fix age limit for average Australians. †¢ Advancement of women: They think women should contribute more to the workplace. So, they encourage participation of women. †¢ Integration of people with a disability: IBM authority thinks that they have a social responsibility for physically and mentally disable people. The authority always tries to create some opportunity of employment for those people. IBM’s most effective diversity programs combine ‘push and pull’ strategies. They have made good headway through company-led, top down practices such as formalized training or policies like floating cultural holidays. However, IBM’s progress comes about through the contributions by individuals who are passionate about diversity issue. Aside from IBM’s diversity team within human resources, three other groups within IBM have formally identified roles in the implementation of the company’s overall diversity strategy. These are IBM’s Diversity Council, diversity contact officers and diversity champions. The Diversity Council The main objective of the IBM’s Diversity Council, is to ensure that the contribution of employees from different background is properly encouraged and valued. Its key objectives are to enhance employee awareness, increase management awareness, and encourage the effective use of IBM’s diverse workforce. This is achieved through personal commitment, regular communication, by gaining support for the program from other IBM managers and influencing decision making. Under the guidance of the Diversity Council, a series of cultural diversity employee roundtables have been held to gather more face-to-face feedback and ideas from staff. These meetings have generated many practical ideas for increasing awareness of cultural diversity within IBM. Professional development IBM has a professional development program. The objective of this program is to ensure that the employees within the organization can identify and remove psychological barriers of diverse workforce and communicate effectively. The main focuses of this program are: †¢ Understanding the cultural bias of each team member and their impact on mutualperceptions. †¢ Determine the reasons why certain behaviors and communication styles fail in somecultures. †¢ Identifying approaches to address cultural gaps that could lead to misunderstandings. †¢ Handling issues about team decision-making, giving or receiving feedback and conflict resolution. Findings: IBM, One of the pioneers of the computer industry started cross cultural communication in 1953. †¢ They think women should contribute more to the workplace. So, they encourage participation of women. †¢ IBM authority thinks that they have a social responsibility for physically and mentally disable people. The authority always tries to create some opportunit y of employment for thosepeople. Recommendations: Considering research and the case of IBM, we have some recommendation here which will decrease discrimination and increase production by making the flow of cross-cultural communication fluent. Those recommendations are as follows: ? IBM should compare their policy for cross cultural communication with others, so that they can get some new ideas to implement in their organization. It will help them to update existing policies as well. ? Not only the HR department of IBM, but also all other employees of the organization should be involved in the process of making cross cultural communication easier. It will help the whole organization to become a good team. ? Training and raising awareness can improve mentality of the employees towards others. They will learn to respect and honor others differences. Place people from different cultures as team leaders. If diverse employees get opportunity to work and share success they will be highly motivated. Discrimination will be dissolved from them and the communication process will work freely. ? A good idea can be to focus different segments one after another so that every segment can achieve expected mentality. This process will form unity and emotion among the employees of the organization. Discrimination will be terminated and the total organization will work as one body. ? Each program introduced in the organization should honor the basic values of the organization. Every program should ensure that none of the employees are discriminated in terms of race, national origin or religion. Conclusion: From the above research we have seen that cultural communication plays a vital role for effective communication for companies around the globe. In our country due to the lack of cultural diversity we do not have to face the problems related to intercultural communication. Many of the successful companies having corporate offices have been able to coordinate their activities through out the world through the successful implementation of cross cultural communication. One of the fore runners in this sector is definitely IBM. IBM has independent division to come up with new policies and strategies to improve cross cultural communication in the workplace. Reference: Boone, L. E. , Kurtz, D. L. , & Block, Judy R. (1997). Contemporary Business Communication (2nd ed. ). Upper Saddle River, New Jersey: Prentince-Hall. 67. Ramsey, James (1999). Available: http://encyclopedia. localcolorart. com/encyclopedia/Cross-cultural_communication/ (July, 17 2005). Carbaugh, D, (1990). Cultural Communication and Intercultural Contact. New York: Pergamon Press. 19. Berko, R. , Rosengeld, L. , & Samovar, L. (1997). Connecting: A Culture Sensitive Approach to Intercultural Communication. Fort Worth, Texas: Harcourt Brace. 121. Porter, R. , and Samovar, L. (1991). Communication Between Cultures. Belmont:NTC Publishing Group. 273. Payne, C. (2001). Culture and Communication. Available: http://www2. mhc. ab. ca/users/cpayne/portfolio/cultcomm/default. htm (July, 29 2005). Appendix [pic] A sample website dedicated to understanding cross-cultural types of issues. [pic] ———————– Idea Letter, Fax, Phone call, E-mail etc. Idea