Computing, Society and Ethics Research Paper Example | Topics and Well Written Essays - 1000 words

Computing, Society and Ethics - Research Paper Example This prevents the distortion of the correct information thus avoiding unnecessary errors during treatment which is administered by the doctor. In addition, the new hybrid robot-assisted procedure reduces the painful operation process and also reduces the time spent on one patient. Advancements in technology result to increased effects of computers to the society, thus ethics should address evolving issues surrounding the use of the remote heart surgery (Duquenoy, Penny, Simon, and Barry 78). In the health sector, the remote controlled robot plays a key role in the entire process of heart disease diagnosis and treatment. It is a vital process in that it directly affects the life of other people thus the standards of its ethics should be high. The remote heart surgery equipment has two parts; the control console and the operating component which is the actual robot. Ethics related to the robot are used in decision making, which is necessary in saving the lives of patients. Written codes relating to cardiac procedures that are robot-assisted guide the doctors in the administration of proper treatment. In their research and implementation of new surgical equipment in the health sector, doctors should abide to the set ethics. Importantly, the remote heart surgery plays a substantial role in these discoveries; thus there should be a close working relationship between the two ethics. The lives of patients suffering from heart disorders depend on the accuracy of the robot arm t hat medics implement for treatment. Often, the robot is directly related to computers as it uses computing commands in its functioning process. This means that computing ethics have a direct effect to the society and influence enormous activities in the surgery procedure (Rosenberg 99). The remote heart surgery is an example of the intensity of computing in treating heart

Why did the reds win the Civil War Essay Example for Free

Why did the reds win the Civil War Essay The Reds won the Civil War for many reasons, but some are specifically more important than others. Some factors such as†¦ Geographical advantage   Strong leadership Unity and organisation   Support Paragraph 1 (Short) (6 mins) The geographical advantage of the Reds helped them with the Civil war because it provided them with military benefits that the Whites did not have. Geographical Factors   Reds: Held central area of Western Russia – Moscow + Petrograd = population for conscription   Whites: Scattered amongst Russia. Reds: Controlled large industrial centers produce war supplies deliver them efficiently amongst soldiers Whites: Communication difficult, hundreds of miles separated different armies – created disunity   How did this help them win? Because they had abundant resources while the Whites did not†¦ Paragraph 2 (Short) (6mins) The Reds won the Civil war partly because of their enemy’s disunity and lack of organisation. The Reds could therefore exploit the White’s major weaknesses in order to secure a victory. Unity + Organisation   Whites: Some members were liberal and just satisfied with the returning of the Provisional government   Whites: The generals distrusted each other Didn’t communicate with each other about attacks bases already far apart Reds: Conscription was introduced and Trotsky hand picked loyal soldiers army increased from 100,000 to 500,000 by August 1918   Reds: January 1920 5 million men enlisted former Tsarist officers held with blackmail   The result? The Campaigns of Kolchak and Deniken contributed to the Red’s victory (lack of troops, unorganised) Production of weapons war communism Paragraph 3 (6 mins) Without a clear sense of direction and leadership the Reds would have had difficulty in their success. Lenin and Trotsky were robust leaders who led the Red’s to their victory. Leadership   Trotsky traveled 65,000 miles throughout Russia assisting front line to encourage Red soldiers.   Lenin clear and structured leadership Whites: Had multiple leaders who set bad examples by drinking. Whites: Aided landlords to gain lost land (lost support from peasants)   Whites: Once peasants conscripted   Brutal discipline = want democracy more   The result? : Better army and more support = victory Paragraph 4 (6mins) Another factor that meant the Reds won the Civil war was because of the amount support they gained in Russia. Support   Reds: gained support through repression and reform Repression: Cheka, grain requisitioning,   Reform: Propaganda, VIK peasant representation of villages in dealings with central government. Briefly mention former Tsarist commanders (blackmail)   Whites: Had foreign aid from France, Japan and USA. Was half hearted and some troops sympathised with Reds. Whites: Peasant soldiers often switched sides, as they were not happy with White’s declaration of returning land back to landlords.   The result? : Had committed troops who fought for them, ensuing in a better army. Conclusion (10) To conclude, I think the main reason as to why the Reds won the Civil war was because of their enemy’s disunity and their lack of support. The White’s became infamous for their terror they brought. Estimated 100,000 – 150,000 Jews in Ukraine and southern Russia were killed in pogroms.   Result? Loss of support   Reds managed to gain 48,000-experienced Tsarist officers   Compare with Whites and their unorganised efforts Effect of good army?   Reds: Ensure loyalty of officers and men, political commissars attached to provide ‘political education’. Whites? Less loyalty   Disunity?   Campaign example Why did the Reds win the Civil War in 1920 Essay Plan.

Willingness of US to go to war :: essays research papers

What I am going to talk about tonight affects all of us. Not just us sitting in this classroom, but it affects everyone on this world. Whether you’re in the U.N. or live in North Korea. America†¦ and their willingness to go to war, for the preservation of their economy and their security. Now, this talk is not anti-American, I have American relatives and I don’t hate them. But what I do hate is this free world democracy spiel which the government are always belching out about. How is America a free democracy with free pres when the country’s inhabitants are so Ill-informed about the rest of the world! The media vilifies the Arab states e.g. Iran, Iraq, Syria even when it was America who installed the dictatorships in the first place for fear of single Islamic entity forming, and they support Israel who are in the process of genocide against Palestinians. The media scares people into thinking that they could be attacked at any moment – even people in rural areas with no landmarks of significance are quaking in their boots for fear of the bearded turban wearing Islamist blowing up their Wal-mart or something! The average American is so scared and ill-informed that they even voted George W. Bush into power for a second term even though there is sufficient evidence to prove that his first victory was fixed. Disenfranchised African Americans, people without criminal records, honest, hard working people were denied their vote. Is this racism The Bush Administration has perfected the art of the fear and consumption tactic. Americans, for fear of their lives from the evil Arab, or the manic ethnic minority (as influenced by shows like cops and world’s scariest police chases) will arm themselves to the teeth and even join the army to fight overseas for what they are brainwashed to believe is liberation. Iraq – Saddam was indeed a brutal dictator, but bombarding a densely populated area with missiles is not the way to remove a man from power. What kill the victims and the killer will follow? Weapons of mass destruction – If there were any at all, wouldn’t you have thought the US would have been able to track them down anyway? I mean where else would Iraq get WMD’s from? Iran? The same Iran they were in a million plus casualty war with in the 80’s? America is the world’s largest economy, generates  ¾ of the world’s turnover, produces the most weapons of mass destruction and has the biggest army in the world.

Periodic Table and Sodium Essay

Sodium, one of many elements in the periodic table is being used in everyday life, it is also an essential element within your body. It is just another element, but one of the differences is that this element is something that most people consume every day. Sodium has played an important role in everyday life because of its uses in medicine, industry, and agriculture(Shriver). Sodium was discovered in 1807 by a man named Sir Humphrey Davy. He was well known for his discoveries of most alkali metals and Alkaline Earth Metals, such as potassium, magnesium, and many more(Chemicool Periodic Table). Sodium is from the alkali metal family. There are five more chemical elements from the same exact family. The period number of sodium is three. Na is the chemical symbol of sodium on the periodic table. Na is the symbol because it comes from the Latin word â€Å"Natrium†, which means sodium (Periodic). It’s atomic number is eleven and it has the atomic mass of 22. 98977, which makes it the fifth largest in its family(Web Elements). Each and every element has difference has a difference between each of them. When Sodium is not exposed to air it is silvery- white in color and is bright and shiny. When it is kept in open air, it becomes dull and gray because of the reaction with the oxygen present in the atmosphere. At room temperature, sodium is found in the form of a solid which is very soft to touch. Due to its softness, you can easily cut it with a table knife(Mukherjee). It’s melting point is 97. 72 degrees Celsius and 207. 9 degrees Fahrenheit. The freezing point is the same as the melting point but the boiling point is 883 degrees Celsius and 1621 degrees Fahrenheit(Web Elements). When a fresh piece of sodium comes in contact with air, it forms sodium oxide and this oxide forms a white coating and protects the metal from any other reaction. The reaction with sodium and water can be very dangerous. Reaction of sodium with water results in sodium hydroxide and hydrogen gas. As heat is produced during this reaction, it is called exothermic reaction. This released heat often burns the hydrogen gas and as a result fire may break out. If large pieces of sodium are put into water it can lead to loud explosions(Mukherjee). Most elements are used in everyday life. They can be used in same ways and different ways. Sodium compounds have many uses in industry, medicine, agriculture, and photography. Manufactures use sodium borate in making ceramics, soaps , and many more. Sodium hydroxide is an important industrial alkali used in refining petroleum and many people take sodium bicarbonate to relieve an overly acid stomach Pure sodium mostly is used in industrial uses. Some is used to produce such metals as titanium and zirconium. One of main everyday uses of sodium that everyone knows about is salt. Forty percent of sodium is used to make salt and most likely people consume salt every day(Shriver). Sodium is the fourth most abundant element and it makes up almost 2. 6% of the Earth’s crust. Another fact is that sodium is highly reactive , which makes the storage of the element a very hard task. The best way to store it is by putting it into liquid hydrocarbons. Sodium is also very important to the body because it helps regulate blood pressure, muscle relaxation, fluid balance in the body, and much more(Periodic Table). This element is incorporated in the project by the using table salt. The table salt represents the element sodium and it will be hit by a marble which will tilt the salt to pour onto the fries. This element was chosen because it is very commonly used in everyday life, it would be very easily incorporated in the project, it was a very interesting element, and while it is very easy to incorporate in the project it also seems very challenging. In conclusion, Sodium is highly used in everyday life. It can be used in medicine, food, and more(Shriver). It has many interesting facts that many people probably do not know, but should know. There are about 115 elements in the periodic table and sodium is just one of those elements(Chemicool Periodic Table)

Coursework on Business Law

The correct citation of The Bankruptcy Abuse Prevention and Consumer Protection Act of 2005 is Public Law No. 109-8, 119. It became fully effective last October 17, 2005. The law implements the new â€Å"means test† to determine whether a debtor is eligible for liquidation which is found in chapter 7 or must file under wage-earner repayment plan found in chapter 13.In order to protect the interests of employees and for reasons of public interest, the law also set supervising random audits and targeted audits to determine whether a liquidation and debtor’s bankruptcy documents are accurate (The Bankruptcy Abuse Prevention and Consumer Protection Act of 2005, 2009, p. 1). It is true that businesses sometimes use bankruptcy as a means to address labor issues which includes reformed contract with the union.The same is true with the case of United Airline Company when it had merger proceedings with US Airways, wherein several union members complained. The labor union is comp osed of the United Flight Attendants wherein its members fought for about 29 days to bring up the pilot's contract dispute (AFA Announces United Flight Attendants Elect Militant Leadership, 2008, p. 1). The contract being fought for becomes successful due to the efforts of union members. Mr. Gardner violated the law.The notice of garnishment on the wages of Clarence Ellis has nothing to do with his job in the company. It was a legal process wherein any person or entity with whom Mr. Ellis was indebted, may take his wages or money in the bank as payment. However, it was not related to the job of Mr. Ellis as laborer and carpenter. Hence, the grounds for firing him such as alcoholism, poor job performance, insubordination, and dishonesty being used by Mr. Gardner are not applicable. Therefore, Mr.Gardner's act of firing Mr. Ellis is baseless. References CBS Interactive Inc. 4 April 2008. AFA Announces United Flight Attendants Elect MilitantLeadership. Retrieved July 1, 2009, from http ://findarticles. com/p/ articles/mi_m0EIN/is_2008_April_4/ai_n25126630/? tag=content-inner;col. U. S. Trustee Program/Dept. Of Justice. 2009. Bankruptcy Abuse Prevention and Consumer Consumer Protection Act of 2005. Retrieved July 1, 2009, from http://www. usdoj. gov/ust/eo/bapcpa/index. htm.

The Marketing Concept

The Marketing Concept Abstract The marketing concept remains a fundamental parameter of marketing that makes organizations meet the needs and wants of their customers thereby surviving and flourishing in the dynamic market. Organizations should treat customers as Kings that is giving them the first priority in all their activities. In laying marketing strategies, organizations ought to consider the tastes and preferences of their customers.Advertising We will write a custom essay sample on The Marketing Concept specifically for you for only $16.05 $11/page Learn More This will enable them to produce services and goods that fit into the customers’ bracket of needs and wants. If this process continues, customers’ satisfaction will be assured leading to attraction and maintenance of customers. Since most firms target profit maximization as their main objective, they will also meet the set objectives in the end thus gaining competitive advantage over their competitors i n the marketing environment. This essay will analyse the relationships that exist between satisfaction of customers’ needs and the organizational needs. It will analyse the marketing concept form a historical perspective and analyse the elements that an organization can do to satisfy its customers. In marketing, customers are the most vital aspect since the main objective is to satisfy their needs. The entire organization should understand and uphold the marketing concept as it is not a single domain of the marketing department (Bell, 2010, p. 27). Success in businesses requires an inclusive approach from all the departments. Every manager and employee should put the customer’s needs and satisfaction in the frontline. The marketing concept and philosophy is involved in product, selling and marketing. Product philosophy enables the organization to know what it can produce and what it cannot produce. It can put emphasis on high quality products with low cost of productio n. This philosophy does not lead to poor sales; instead, it creates more market for products made than before. During the industrial revolution, the production was extremely low as goods were made using hands, but the goods were still marketed. Customer’s satisfaction was extremely low because of low and slow production that led to low market. Currently, there is mass production, but it has not covered all customers’ satisfaction.Advertising Looking for essay on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More However, it has created economies of scale thereby leading to low cost of production and low price of goods (Hooley et al., 1995, p. 10). This implies that the production philosophy can work in a newly established industry. According to Henry Ford, different colour of products can increase the cost of production, which leads to more market. He argued that to get more customers, one should lowe r prices for goods (Cochran, 2003, p. 15). During the Industrial revolution, there was an increase in the volume of products; this prompted the need for a marketing department that will focus on selling of the goods. Increase in supply and production brought to an end the surplus production leading to advertising and personal selling to reduce inventories and increase sales. Additionally, it enables the organization to focus on the production work, and sell whatever property they produce. Nevertheless, distributing goods according to the consumer’s preference is easier. Further, a good sales department cannot meet the needs of all customers since the customers have many choices. It struggles to make the organization understand the customers before designing and making products. When needs and wants of customers are included in the production work, the organization will increase sales since they will meet the customer’s preference thereby maximizing its profit. The mana gement in organizations should be skilful in order to understand their customers, as this is the key to quality service provision (Cochran, 2003, p. 17). In environmental scanning and forecasting, firms should be able to foresee the needs of their customers. This approach will help organizations meet and exceed the expectations of their customers. In addition, organizations that understand the needs of their customers will be able to alter their services and goods in line with the customers’ change in tastes and preferences in future.Advertising We will write a custom essay sample on The Marketing Concept specifically for you for only $16.05 $11/page Learn More They can do this without any challenge of reorganization or loss since they keep continuous contact with their customers. Markedly, continuous contact with customers requires an attentive management that can listen to complains that customers raise and reward perennial ones; this increases the ir loyalty to the business. Major business organizational units aim at surviving in the market. How a firm manages its working capital determines its financial health or status. Strategic working capital policies should be available to ensure that the firm will make profit even during a financial crisis. This management helps to generate new capital to settle future debts. A good management of working capital can also make it possible for firms to engage in risky ventures, which have huge returns (McClelland, 1995, p. 97). Therefore, it encourages investment options that can fully satisfy the needs of the customers. Secondly, organizations target growth and development of their internal services in terms of institutional and professional competency, innovations in products and services and customer growth. Firms also aim at fostering strong relationships among its external networks. Lastly, another organizational need is serving and uplifting all its stakeholders; for instance, an o rganization can engage in Corporate Social Responsibility (CSR) to make changes in the world. It can also encourage its employees to work towards achieving their life objectives through continuous training on life skills. Customers will also like an organization that educates them on the content of various products and how to use them. For organizations to understand their customers, they should try to be in the customers’ shoes, use various organizational data, or even ask the customers on what they think on productivity and service provision. Using the Customer Relationship Management system (CRM) can assist firms to understand the needs of their customers. This data shows how customers take orders and how quick the company delivers these orders. CRM systems contain information on consumer behaviours and preferences that can help an organization to identify various needs of its customers’ thereby increasing profitability (Mckitterick, 2000, p. 21). If an organization utilizes this data carefully, it can improve in customer satisfaction and retention.Advertising Looking for essay on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More A customer survey can also be helpful to an organization that is interested in meeting the needs and wants of its customers. In engaging customers in a satisfaction survey, they feel more valued than in another firm that does not inquire on their views and contributions. Notably, a firm can gain meaningful insights if it goes ahead to inculcate the views of customers when making improvements or changes in their services. Such a scenario will increase customers’ loyalty, which makes it easier for the firm to understand the needs of these customers hence tailor its products towards satisfying these needs. Evidently, such a marketing strategy will alter the performance of a firm since the customers will be able to inform the organization of the behaviours that they feel should be altered. For instance, customers can inform the organization of bad behaviours among its staff only if they are close to the management. If the management can proactively consult its customers, it will be able to correct its wrong doings that could have caused dissatisfaction to customers. Moreover, an organization can opt to be in its customer’s shoes. In this manner, the management will study the points at which the customers access the enterprise. Some of these points include deliveries, phone calls, and correspondence; the management should scrutinize if there is immediate responses to phone calls and the friendliness of its receptionists. The slowness in handling customers’ complains coupled with the arrogance of the receptionist can be the reason behind customers’ dissatisfaction. To avoid losing customers, the management should try to put the interest of its customers at the forefront by addressing their complaints promptly (Mckitterick, 2000, p. 23). Further, the firm should deliver on it promises and even surpass the customers’ targets. All the departments in an organization should focus on surpassing the expectations of the customers. Understa nding the customers remains a secret that businesses can use in identifying the needs and wants of its customers thereby enhancing satisfaction among the customers. Markedly, a firm will realize and surpass its organizational goals of continuous expansion and growth in the market with continuous loyalty of customers. In meeting the customers’ needs, businesses should design products and services that are affordable, attractive, work well and always available. They also engage in product promotion to alert consumers on the existence of their products hence encouraging them to purchase the products. In the current market, customers tend to adopt the new technological systems such as online shopping. An organization should upgrade its information management system in order to be in line with the requirements of the customers. First, organizations with updated Information Management (IM) have all their data well managed in the systems. This information management fosters growth, as it reduces the cost of operation (Bhatt, 2010). Organizations can develop websites that can promote communication. For example, pizza companies have designed a website where their customers can order their own pizzas from the stores. Since organizations handle large volumes of data, there is the need to employ the Information Technology in ensuring proper data storage. Organizations handle clients’ data, employees’ data, managerial data, suppliers, and procurements data amongst others. There is the need to align these pieces of information for easy access by the prospective owners and the organization. This is where the Information management is applicable. Research has revealed that businesses that have a well-organized and managed data improve customer satisfaction minimize cost on IT thus increase revenue and realize improvement on operational efficiency. Further, a properly managed IM eliminates decisions based on assumptions as the information can be retrieved within the shortest time possible; it enables organizations understands their customers’ behaviours and preferences. This enables organizations to serve their clients well and even retain most of them (Bhatt, 2010). IM also increases efficiency as customer care agents can access clients’ data at an instant. Business outlets are inculcating technological modifications into their systems in order to increase their efficiency and reduce the cost of operation. Organizations should use specifications or approaches that they can undertake. Remarkably, the success of Information Management depends on their alignment and integration with the Human Resource (HR) and organization’s objectives. Clearly, an organization that tends to meet the meet the needs of its customers will actually meet its strategic goals and objectives. The customer service department in an organization can assist in attracting, serving, and retaining customers by applying proper knowledge managemen t techniques. Knowledge Management (KM) can assist a firm to predict the future behaviour of its customers in terms of their tastes and preferences. Therefore, KM and environmental forecasting can help a firm to save on the cost of production; therefore, it can direct these funds in expanding its services to occupy large market area (Pride Ferrell, 2002, p. 45). Such a firm will avoid wastage on producing goods or services that will not receive positive market response. Understanding the needs of customers is the job of all departments in an organization. From the above analysis, businesses should put more resources on researches that aim at learning the needs of their customers. Customers remain the epicentre of all businesses since without them, no transaction will occur. Organizations should pay immense attention to the behaviour and complaints of their customers to ensure continuity. An organization that is updated on technology, provides a variety of products, and interacts fr eely with its customers will satisfy the needs of its customers. This act will increase profitability of the organization. The firm will use the profit to expand its services and invest in other risky, but profitable ventures. Therefore, organizations that align their strategic objectives towards customers’ satisfaction will achieve their missions. References Bell, M. L. (2010). Marketing; Concepts and Strategy. University of Minnesota: Houghton Mifflin. Bhatt, Y. (2010, March 1). Information Management: A Key for Creating Business Value. The Data Administration Newsletter – TDAN.com. Retrieved from http://tdan.com/information-management-a-key-for-creating-business-value/12829 Cochran, C. (2003). Customer satisfaction: tools, techniques, and formulas for success. Chico, Calif.: Paton Press. Hooley, G. J., Lynch, J. E., Shepherd, J. (1995). The Marketing Concept: Putting the Theory into Practice. European Journal of Marketing, 24(9), 7-24. Web. McClelland, S. B. (1995) . Organizational Needs Assessments: Design, Facilitating and Analysis. Atlanta: Greenwood Publishing Group. Mckitterick, J. (2000). What is the Marketing Management Concept?. Chicago: Houghton Mifflin. Pride, W., Ferrell, O. C. (2002). Marketing: Concept and Strategies. Abingdon: Deep Deep Publications.

The Quest For Fortune in Antebellum America essays

The Quest For Fortune in Antebellum America essays The California gold rush of the mid-nineteenth century was an event which exemplified the eager American spirit of the time. Not long after word spread of the discovery of gold near the lower Sacramento Valley in 1848, thousands of hopefuls from the world over rushed to California with dreams of finding their fortune. This rush led to exponential expansion of the California economy, with prices reaching new heights and homes sprouting as quickly as they could be built. Edward Gould Buffum, and army lieutenant, was one such individual who experienced success in his endeavors. He wrote a narrative of his quest for gold published in 1850, entitled Six Months in the Gold Mines. This book was intended for a public audience, and might have been read by anyone interested in California and the gold rush. In the excerpts from this book printed in America Firsthand, Buffum details parts of his quest, and describes certain procedures for obtaining gold. He discusses different techniques of mining, and how the gold is naturally accumulated in the sources from which it is mined. Buffum describes several specific sites where he found success, and the genuine excitement he felt upon discovery. In the last excerpt, he describes the economic changes that have taken place in certain parts of California in such short times as a result of the gold rush. Six Months in the Gold Mines, by Edward Gould Buffum, is a tool which historians can use to learn about the ways of life of the typical American fortune-seeker of the gold rush, including travel and living patterns, speculation and uncertainty, the motive of greed, and resultant economic The first excerpt begins with Buffums expedition on the Yuba River. He educates the ignorant reader to certain terminology related to mining, and describes the rocking machine used to extract the precious gold. Buffum barely b...

Nitrogen or Azote Facts

Nitrogen or Azote Facts Nitrogen (Azote) is an important nonmetal and the most abundant gas in the Earths atmosphere. Nitrogen Facts Nitrogen Atomic Number: 7 Nitrogen Symbol: N (Az, French) Nitrogen Atomic Weight: 14.00674 Nitrogen Discovery: Daniel Rutherford 1772 (Scotland): Rutherford removed oxygen and carbon dioxide from the air and showed that the residual gas would not support combustion or living organisms. Electron Configuration: [He]2s22p3 Word Origin: Latin: nitrum, Greek: nitron and genes; native soda, forming. Nitrogen was sometimes referred to as burnt or dephlogisticated air. The French chemist Antoine Laurent Lavoisier named nitrogen azote, meaning without life. Properties: Nitrogen gas is colorless, odorless, and relatively inert. Liquid nitrogen is also colorless and odorless and is similar in appearance to water. There are two allotropic forms of solid nitrogen, a and b, with a transition between the two forms at -237 ° C. Nitrogens melting point is -209.86 ° C, boiling point is -195.8 ° C, density is 1.2506 g/l, specific gravity is 0.0808 (-195.8 ° C) for the liquid and 1.026 (-252 ° C) for the solid. Nitrogen has a valence of 3 or 5. Uses: Nitrogen compounds are found in foods, fertilizers, poisons, and explosives. Nitrogen gas is used as a blanketing medium during the production of electronic components. Nitrogen is also used in annealing stainless steels and other steel products. Liquid nitrogen is used as a refrigerant. Although nitrogen gas is fairly inert, soil bacteria can fix nitrogen into a usable form, which plants and animals can then utilize. Nitrogen is a component of all proteins. Nitrogen is responsible for the orange-red, blue-green, blue-violet, and deep violet colors of the aurora. Sources: Nitrogen gas (N2) makes up 78.1% of the volume of the Earth’s air. Nitrogen gas is obtained by liquefaction and fractional distillation from the atmosphere. Nitrogen gas also can be prepared by heating a water solution of ammonium nitrite (NH4NO3). Nitrogen is found in all living organisms. Ammonia (NH3), an important commercial nitrogen compound, is often the starting compound for many other nitrogen compounds. Ammonia may be produced using the Haber process. Element Classification: Non-Metal Density (g/cc): 0.808 ( -195.8 °C) Isotopes: There are 16 known isotopes of nitrogen ranging from N-10 to N-25. There are two stable isotopes: N-14 and N-15. N-14 is the most common isotope accounting for 99.6% of natural nitrogen. Appearance: Colorless, odorless, tasteless, and mainly inert gas. Atomic Radius (pm): 92 Atomic Volume (cc/mol): 17.3 Covalent Radius (pm): 75 Ionic Radius: 13 (5e) 171 (-3e) Specific Heat (20 °C J/g mol): 1.042 (N-N) Pauling Negativity Number: 3.04 First Ionizing Energy (kJ/mol): 1401.5 Oxidation States: 5, 4, 3, 2, -3 Lattice Structure: Hexagonal Lattice Constant (Ã…): 4.039 Lattice C/A Ratio: 1.651 Magnetic Ordering: diamagnetic Thermal Conductivity (300 K): 25.83 m W ·m−1 ·K−1 Speed of Sound (gas, 27  °C): 353 m/s CAS Registry Number: 7727-37-9 References: Los Alamos National Laboratory (2001), Crescent Chemical Company (2001), Langes Handbook of Chemistry (1952) International Atomic Energy Agency ENSDF database (Oct 2010)Return to the Periodic Table  of the Elements.

Purpose Essay Example | Topics and Well Written Essays - 3750 words

Purpose - Essay Example Disadvantages, in this case, refer to the problems that may be caused when the goods are consumed. The main purpose of Hazard communication is to ensure that the existing dangers or hazards of all the chemicals produced locally or imported are evaluated properly, and thus any information concerning their dangers are revealed or transmitted to the employees and the employers, as well. The transmittal is always accomplished by means of effective and comprehensive hazard programs. The programs include container labeling, material safety data sheets, as well as, employee training. Problem Definition Safety dangers or hazards related to physical features and characteristics can be easily and objectively defined with the use of testing requirements such as flammability. The definition of health hazards is more subjective and less precise. Health hazards, as understood and explained by health specialists, can result into measurable changes in the human body, for instance, reduced pulmonary function. The changes are indicated by the occurrences and the presences of symptoms and signs among the employees exposed to them. Such symptoms include a non measurable subjective feeling, as well as, shortness of breath. Determination of occupational health hazards always prove a great challenge, complicated by the fact that many of the common effects or signs occur mainly in non-occupationally exposed populations, in such away that the exposure effects are difficult or challenging to separate from the common and recurring illnesses. There are occasional situations whereby a substance may cause an effect hardly seen or visible in the population, at large. An example is angiosarcomas, which results from the exposure to vinyl chloride. This makes it easier for the establishment of the certainties that the occupational was the actual and the primary causative agent. Nevertheless, the effects are common, for instance, lung cancer. Normally, the situation becomes worse and complicated due to the fact that most chemicals have not been well adequately tested in order to determine the potential of their health hazards, and the data does not exist for the substantiation of the effects. Efforts by many scientists have come up with results and basis of categorizing effects, as well as, their definition in many ways. The general or the overall accepted terms â€Å"chronic† and â€Å"acute† used or applied in this area to come to the delineation between the effects on fundamental basis of duration or severity. â€Å"Acute† effects normally happen rapidly due to exposures that are considered short terms, and are always of short duration. â€Å"Chronic† effects occur due to long term exposures of an individual to the hazards. Unlike the Acute ones, they are of long term durations. The acute effects, that are most frequently referred, in this case, are those that defined by the US major body, the American National Standards of Institute (ANSI) s tandard for the Precautionary Labeling of Hazardous Industrial Chemicals (osha.cov). Such hazards include corrosivity, lethal dose and sensitization. Despite these being obvious health effects, they never cover adequately the chronic effect areas, excluding, for instance, the blood dyscrasias such as anemia, liver atrophy and bronchitis. The same is applicable with the term chronic effect, which is often used in the reference to only

Analytic exercise Essay Example | Topics and Well Written Essays - 500 words

Analytic exercise - Essay Example tting up, he finds himself as a vermin, but he continuously ponders over his routine life and concludes that he may be considering him transformed because of lack of proper rest and intensely busy routine. In the first passage, Samsa awakens from troubled dreams and them we can find the mentioning of dream, uneasy sleep, waking up early, lack of rest and other hints pointing towards busy life and comfortless sleeping of the protagonist that connects the whole text and makes it unified. A text has connections (Hoey 2000). The text has long and short, both kinds of sentences for creating an informal tone. The written content appears as a personal narration of Samsa in place of written by some other author. For example, first he tells about his transformation, then his busy routine and restlessness and then, connects his present situation to the reasons of his restless life. Metaphors are part of our daily life (Lakoff & Johnson 1981). The writer of the text makes use of metaphorical language to put forward his perspective about modern life and busy routines of people. The theme of seclusion is represented by the physical transformation of the protagonist. The writer uses the metaphor of metamorphosis of the protagonist indicating towards an insect like development of his character. His transformation points towards his loneliness and seclusion that is further strengthened by his physical changing. The writer also uses the metaphor of troubled dreams to indicate towards restless sleep of the protagonist. The discourse of the text is divided into chunks of past and present narration by the protagonist, but all the chunks are interconnected to form a unified text (Fairclough 2003). The phrases like ‘strenuous career’, ‘getting up early all the time’, ‘horrible vermin†¦.with many legs’ and ‘travelling day in and day out’, all point towards tormented life and separated being of the protagonist. The text has passive as well as active voice usage

Response Paper Coursework Example | Topics and Well Written Essays - 500 words

Response Paper - Coursework Example Up to date a lot of research still show that railroad transport still remains as an imperative of the growth of many economies for example the when you follow the economic history of the in transport, you find that railroads transport has a lot of influence on the American development since most of the industrial developments, agriculture and even the settlement of the West would have not been possible without it. The problem with the viewpoint is that it gives imperative ideas that only demonstrate the associations that exists between the growth of the railroad network and the growth of the economy but fails to give an establishment of the causal relationship that exist between the railroad and the reorganization of the trade in various regions, the changes that are seen in the structure of the outputs or even other strategic changes that characterize the economy of America such as the rise in the per capita income. It also fails to establish the prima face that justifies the railroad as necessary conditions for any form of developments. The building and construction of such big network of transportation require a large starting capital that may take the form of large volumes of goods such as finances, iron, lumber and even other transport equipment. The particular relevance of the Morris Raphael was not only to the novelty of his viewpoint but on how he summarized the conclusion on for both who lived in the period of railroad revolution and those people who later analyzed it through the lens of past times. It means that it is cheaper to use the railroad means to transport freights that to use the canals or water since railroad can carry five times more than what the canals can carry. Though they provide the same service but railroad provides it at a lower cost to the buyers. The decisive advantage of the railroad over canals and

Reflection Essay Example | Topics and Well Written Essays - 500 words - 78

Reflection - Essay Example The first priority of the HR managers and officers are staffing, employment, and recruitment of staff (HR’s Evolving Role†¦, 2008). However, today the HR practitioners are performing roles such as performance management, policy development, and employee communication. In addition, the HR professionals have adopted other responsibilities such as employee counseling, and account administration, which helps in utilizing the full potential of the resource managers. The other roles currently performed by the HR managers are organizational development and legal compliance. In addition, the HR managers enable organizations to perform efficiently and compete with the other businesses. Technology plays an important role in several organizations and the HR departments are currently engaging in human resource information systems. The systems help in the performance and development of the entire organization. The factors, which have contributed to the changes in the HR profession, are the technology advancement, competition, and the need to utilize the innovative potential of every employee. The development in the modern technology affects all departments in any organization especially the HR. human resource information systems management is a vital role played by the HR professionals in their daily activities. Keeping employee data and any other information requires the HR staff to be conversant with computer knowledge and many of the application software (HR’s Evolving Role..., 2008). Competition is nowadays a challenge to many organizations as everyone strives to take the organization to a higher level. Competition, therefore, has made many organizations make use of all the staff including the HR professionals to help in brainstorming and giving ideas for a positive progress of the company. Innovation is very important in ensuring the growth of

Supply chain management Essay Example | Topics and Well Written Essays - 1250 words

Supply chain management - Essay Example Some scholars revealed that they were unable to find the difference between purchase and supply chain management. Additionally, some marketing analysts have viewed supply chain management as about creating the purchasers creating good relations with their entrusted suppliers. Others argue that supply chain management is not good enough since it does not accommodate all the marketing processes from the industries to the consumers of the goods. The researchers involved these different people to sample their view about the supply chain management as part of the agenda 3. The theory of supply chain management tends to rotate between prescriptions, trend, and description. A major trend identified is the anxiety with the outcome of supply chain management on a variety of marketing functions.The current trend in the market is that supply chain is hastening the corporate theme and there is a lot of proof for this. For instance, some established companies have hired supply chain managers and there has been contest between supply chains rather than between the companies. 3. Christopher, M., (1998), Logistics & Supply Chain Management, Pearson Education Limited, Harlow. The above stated example gives a major problem in the discipline of supply network 4. Most businesspersons use an already established domain related with supplier-buyer behavioral mechanism although it has its own weaknesses. Most of these problems relate management issues, choosing the best supplier of goods among others and these can result from the failure of this field to try the broader concept of

Reflection Essay Example | Topics and Well Written Essays - 500 words - 78

Reflection - Essay Example The first priority of the HR managers and officers are staffing, employment, and recruitment of staff (HR’s Evolving Role†¦, 2008). However, today the HR practitioners are performing roles such as performance management, policy development, and employee communication. In addition, the HR professionals have adopted other responsibilities such as employee counseling, and account administration, which helps in utilizing the full potential of the resource managers. The other roles currently performed by the HR managers are organizational development and legal compliance. In addition, the HR managers enable organizations to perform efficiently and compete with the other businesses. Technology plays an important role in several organizations and the HR departments are currently engaging in human resource information systems. The systems help in the performance and development of the entire organization. The factors, which have contributed to the changes in the HR profession, are the technology advancement, competition, and the need to utilize the innovative potential of every employee. The development in the modern technology affects all departments in any organization especially the HR. human resource information systems management is a vital role played by the HR professionals in their daily activities. Keeping employee data and any other information requires the HR staff to be conversant with computer knowledge and many of the application software (HR’s Evolving Role..., 2008). Competition is nowadays a challenge to many organizations as everyone strives to take the organization to a higher level. Competition, therefore, has made many organizations make use of all the staff including the HR professionals to help in brainstorming and giving ideas for a positive progress of the company. Innovation is very important in ensuring the growth of

Minimum Wage is a frequent topic of political debate. Analyze the pros Essay

Minimum Wage is a frequent topic of political debate. Analyze the pros and cons of such a policy using the relevant theoretical - Essay Example This made it a requirement of all states to set this as their minimum wage limit but this does not make it mandatory because some states exhibit variations of this set minimum. Some states, like California, have higher limits of this wage, which is at $8.00 while others, like Georgia, have wage limits below that federal limit at $5.15 per hour. These differences are made possible, by the municipal and state laws, which make it possible, for individual states to set their own minimum wage limits by exercising their right to enact their own by laws. This enables them to determine the limit of minimum wage, with respect to the economic potential of that a given state because it would not make sense to match the minimum wage with a rich state in terms of resources. This is an analytical discussion about the advantages and disadvantages of the minimum wage policy in the United States of America using a theoretical construct approach. Minimum wage from an economists view is disadvantageous to the market system of demand and supply. This is because when the minimum wage is raised the number of people vying for that job position increase, but the employer’s willingness to offer the position decreases because it is an increase in expenses in terms of salaries. In this scenario, employers would rather delegate the duties to be filled, by the new position to existing employees, than offering the job position. On the other hand, if the minimum wage were reduced, it would give employers an opportunity to create more job opportunities in organizations because they can afford to do so. This would depend on the amount of the wage set because a minimum wage of $1 per hour would not attract anyone, but student workers could consider a $4 per hour. Setting up the minimum wage law disrupted the functioning of supply and demand system because it dictates what employers should pay, instead of letting the two factors standardize the field on their own. Market factors of demand and supply govern the number and type of jobs available along what each job category would pay (Schmidt, 19). Increasing the minimum wage deprives a group of young Americans the much needed life lessons, which can be acquired when one works minimum wage job. This is because these jobs are popular with interns, workers in training and students, which help them, learn early in life how to handle money and relate with people in different circumstances (Schmidt, 16). They instill the values of hard work, responsibility and hard work early in their lives and motivate them to aspire to go to college and acquire advanced skills, which can enable them get better paying jobs in the future. Raising the minimum wage reduces the number of these types of jobs because employers will not be willing to offer these job positions because of increased salaries. This will translate to the emergence of a generation of Americans who have no value for hard work and responsibility, which would be detrimen tal to the economy of the country. It means that most of the American society in the future will lack a driving force that is essential in inculcating work ethics that are vital to a vibrant economy characterized by a work force that knows and understands the benefits of hard work. An increase in the minimum wage will result in a decrease of job opportunities that offer invaluable experience that is a prerequisite in almost all well paying and stimulating jobs in America. New entrants into

Graphic Novels in education Essay Example for Free

Graphic Novels in education Essay Graphic novels and comic books have been some of the most debated topics recently in many different areas. Many people think that they could be helpful in education, while some others completely disagree. Some people think they are childish, and some think they require just as much comprehension as long, fictional novels. However, despite all the criticism graphic novels often get, the genre is growing recently. Many things have led to this rise in interest, from easier access on the Internet to the many superhero movies sparking interest in a younger audience. Due to this recent rise in popularity for graphic novels, several people believe that this genre can be helpful in all levels of education. There are positives and negatives to this possibility, like everything else, but the positives seem to outweigh the negatives. One thing that weighs in favor of adding more graphic novels into education is that they are easier to read and can be more encouraging for students who may not like to read. There are several things that one must be able to do to read and understand graphic novels, including comprehending visual imagery and making inferences. The biggest factors that are helping push graphic novels into education are what was just mentioned; the way students now learn, the need to make inferences, and the need for students to learn visually. Every teacher can admit to having a few students in class that were not particularly good readers or that did not enjoy reading. If graphic novels were read more widely in classrooms, that would help with these certain students learning. The vocabulary and diction used in this genre is much simpler than in most word-based novels that would be read in class. Often, students who are given a very long book, they simply do not even read for their assignments. However, if one of these same students was given a longer graphic novel, like Watchmen for example, it is very likely that they would be more willing to read. Another method that makes these works easier for some students is that the words are more spread out, which makes the student only comprehend small parts at a time. This makes students who are less confident with their reading skills able to better manage comprehending the purpose in a novel. Although the speech in graphic novels is simpler, students are still â€Å"challenged by the need to infer and decipher a variety of literary devices† (Constantino). Another positive factor in graphic novels is how visual it is. Children today are becoming much more visual learners. This is probably due to the prevalence of television and computers in today’s society. While, television and computers have often been looked at as negative impacts in children’s learning, many students have figured out that there are good things on television and the internet. Also, these students have found out that there are books that are not particularly good, despite what they have been taught. While there is still going to be those people out there who will have their doubts about allowing this genre in education, students would benefit from having more visual learning and less long narratives in class, which is just what graphic novels would bring. One of the most important abilities for a student when reading is learning how to make inferences. Many times in comics and graphic novels, the author will give a â€Å"bare outline† of what is going on, and leave the reader to â€Å"fill in the blanks† with the scenery or facial expressions of the characters (Walter). This ability is key to not only reading, but also in daily life. Inferences often need to be made in conversation to know exactly what situation that person is going through. If graphic novels were added to more school’s curriculum, then not only would students’ reading abilities improve, but their conversational skills would also improve. The reader of comics must also be able to decode the messages that the writer displays in his work. No matter how discrete of a message the author may insert into a work, the reader must be able to put together the pieces of the puzzle to create a continuous story. The reader must perform closure in between the â€Å"encapsulated moments in order to create a completed whole out of fragments† (Duncan and Smith 12). This closure that the reader must make is very similar to making inferences. To do both, one must apply background knowledge and relate events that may be described indirectly to blend these sequences into a constant story. Because of the important skill of making inferences that is necessary to read and understand graphic novels, they can be used as a gateway to reading more challenging works by developing this skill in children. As was mentioned previously, children are relying more and more on learning through visual techniques. Because of that, comics can be much more helpful than long narratives in teaching students to understand imagery, tone, symbolism, and many others. One example of how visual aids can help students learn is by using facial expression or body language of the drawn characters in graphic novels. Students will be able to gain many details of the story by simply looking at these two things. By looking at a character’s facial expression, one can learn the current mood of the story, along with what tone the character may be using. Teaching students to look at these things will not just help them when reading a graphic novel, it can also help them figure out certain situations that may occur during their lives. While some people argue that graphic novels are much simpler or not as mentally stimulating, they do share some characteristics with text-based narratives. One characteristic in particular is that they both use onomatopoeia. While these text-based narratives will insert these words into a sentence, graphic novels will make an entire panel out of one of these words. Although both of these genres do use onomatopoeia equally as much, the usage in graphic novels is more imaginative. In graphic novels, the word is usually brought to the center of the page, and made colorful and exciting. Because of the way that graphic novels display this literary technique, students can easier realize when that literary device is being used. Students can get a better understanding of when this literary device is applicable, and that will make them more confident as they continue reading. Despite the fact that graphic novels can often maintain a simpler vocabulary, they can still teach students simple literary devices like onomatopoeia. While the vocabulary is usually simpler, the material is more complex. As Linda Starr states in her article, an advantage of using graphic novels in the classroom is that these books â€Å"present complex material in readable text†. This gives graphic novels an advantage over other, harder to read, novels because more often than not, these students have a greater understanding of issues that are dealt with in books, but not all the time can they decipher what the issues are because of the more difficult vocabulary. One way to simplify things for these students, while still challenging them mentally is to provide more graphic novels in the curriculum. There is always going to be crowds of people who will deny graphic novels ever being relevant in education, but the different ways students are learning, the way students must make inferences, and the visual techniques that are displayed in graphic novels all provide reasons why these texts should be included in the classroom today. Graphic novels can serve as a spring into a lifelong love of reading or it can simply keep the student interested enough to get through an assignment. Whatever a student’s level of reading skill, there is no doubt that they will be able to read a graphic novel, while still maintaining a certain complexity in the ideas presented. Graphic novels can also teach students how to make inferences, as well as recognize and understand common literary techniques. Above all, students’ imaginations, and possibly interests will rise because of this genre being implemented into a curriculum. As Jesse Karp notes about graphic novels, â€Å"the form reaches young people in a way no other can†, and that is what is most important to future students’ learning. Works Cited Constantino, Correne. â€Å"Teaching English and Reading with Graphic Novels†. Education. cu-portland. edu. Concordia University, n. d. Web. 3 May 2013. Randy Duncan and Matthew J. Smith. The Power of Comics: History, Form and Culture. New York: The Continuum International Publishing Group, 2009. Print. Karp, Jesse. â€Å"The Case for Graphic Novels in Education†. Americanlibrariesmagazine. org. Chicago: American Library Associarion, 1 Aug. 2011. Web. 3 May 2013. Starr, Linda. â€Å"Eek! Comics in the Classroom! †. Educationworld. com. Education World, 11 Jan. 2008. Web. 3 May 2013. Walter, Carlene. â€Å"Graphic Novels†. Eclection. wikispaces. com. Tangient LLC, n. d. Web. 3 May 2013.

Encoding RIP from Elaeis Guaneensis Jacq

Encoding RIP from Elaeis Guaneensis Jacq Detection and expression profiling of two novel transcripts encoding RIP from Elaeis guaneensis Jacq. in Ganoderma boninense interaction 1. Introduction Among several oil-producing plants, oil palm (Elaeis guineensis) is a tropical crop which is exclusively grown for oil production. Its high oil yield is extracted from oil palm’s thick fleshy mesocarp which is extremely rich in oil (80% of dry mass). Furthermore, oil palm has the highest oil production (oil per unit land) compared to other oil-producing plants. The extracted oil has been used widely for several applications including, food, cosmetics, and bio-fuel (Paterson 2007; Murphy 2009; Alizadeh et al. 2013). Among various diseases , the basal stem rot (BSR) is known to be the most serious disease in oil palm (Ho and Nawawi 1985). Furthermore, the BSR is caused by Ganoderma boninense which is considered specifically as a â€Å"white rot fungus†. The lignin is broken by the fungus leaving whitish cellulose exposed (Paterson 2007). The infection process is initiated when the oil palm roots are penetrated by fungal mycelia, which is spread out to the stem bole, after which the trunk eventually collapses (Rees et al. 2009). Malaysia and Indonesia have suffered the most severe losses from the BSR; furthermore, the diseases has been identified in Malaysia several decades ago (Ho and Nawawi 1985; Idris et al. 2004; Rees et al. 2007). Oil palms of different genetic origins have shown to have resistance to BSR. However, the genes involved in the resistance of oil palms against G. Boninense were unknown (Idris et al. 2004; Durand-Gasselin et al. 2005). Recently, few defence related genes were identified in oil palm. The major pathogen on oil palm in Malaysia has been identified as G. boninense Pat. Stem rots of oil palm caused by species of Ganoderma are a major threat to the sustainability of the oil palm production. In this study, we have isolated one cDNA encoding RIP’s EST, from oil palm. Its expression in oil palm root infected by G. boninese; was investigated to shed light on its potential involvement during early disease development. 2. Materials and methods 2.1 Sample preparation A total of 24 six-month-old oil palm seedlings (Elaeis guineensis Jacq., DxP, GH500 series) were purchased from Sime Darby Plantation Sdn. Bhd. (Banting Malaysia) and divided into two groups with 12 seedlings in each group, one of these groups were treated with Ganoderma boninense Pat. Strain PER71, while the remaining group served as controls. Seedlings treated with G.boninense were inoculated by sitting each seedling on rubber woodblock fully grown with G.boninense PER71 while the other group of seedlings were inoculated with fungal surface mulch as described by (Alizadeh et al., 2011). Three biological replicates of the seedlings were harvested from each treatment at 4, 8, 12 wpi, respectively. The leaves, roots and stem cell were frozen in liquid nitrogen and stored at -80 °C (Tan et al., 2013). 2.2 RNA extraction Total RNA was extracted from treated and untreated oil palm root tissues using a modified CTAB method briefly, 0.1 g tissue was ground in liquid nitrogen into a very find powder. The powder was immediately transferred into 1.5 ml extraction CTAB buffer [ 2% (w/v) cetyl trimethyl ammonium bromide, CTAB; 100mM Tris-HCl, pH 8.0; 2M NaCl; 25 mM ethylenediamineteraacetic acid, EDTA; pH 8.0; 2% (w/v) polyvinylpyrrolidone, PVP; and 2% (v/v) ÃŽ ²-mercaptoethanool]. Equal volume of chloroform/isoamylalcohol (24:1, v/v) was added into the tube and centrifuged at 12,857 g for 15 min at 4 °C. The upper layer was transferred into a new tube and equal volume of phenol/chloroform/isoamylalcohol (25:24:1, v/v/v) was added and centrifuged. This step was repeated until a clear supernatant was obtained. The supernatant was adjusted to a final concentration of 2M LiCl, and incubated at 4 °C for overnight, and then centrifuged. The RNA was dissolved in 5ml diethypyrocarbonate (DEPC) – treated water. An equal volume of chloroform/isoamylalcohol was added, mixed, and centrifuged at 12,857 for 30 min at 4 °C. Precipitation of RNA was performed by adding 0.1 vol of 3M sodium acetate (pH 5.2), 2 vol 100% ethanol and incubated at -80 °C for overnight. After centrifugation, the pellet was washed using 70% ethanol and dissolved in 20ul DEPC-treated water. The quality of RNA was examined by using a Nanodrop( BioRad) at 230, 260 and 280 nm. The RNA integrity was examined using 1.5% agarose gel electrophoresis. The RNA was treated with DNase I (Qiagen, USA) following the manufacturer’s instructions. Figure : Total RNA from various treated and untreated oil palm tissues. Lane A: Untreated control seedling. Lane B: Treated seedlings. 1) Leaf. 2) Basal stem. 3) Root 3. Semi-quantitative Reverse transcriptase (RT-) PCR 3.1 Isolation of cDNA Omniscript â„ ¢ Reverse Transcriptase kit (Qiagen Kit) was used for cDNA synthesis by the following kit manuscript. To obtain the sequence of cDNA from oil palm, gene specific primers were designed based on oil palm expressed sequence tag (EST) (Ho, 2010) and RIP’s type I alignments, using primer 3 version 0.4.0(frodo.wi.mit.edu). 3.2 Sequence analysis of cDNA Semi-quantitative Reverse transcriptase (RT-) PCR was performed on EST using PCR machine with Reverse transcriptase enzyme. Equal amounts of RNA (1ug) extracted from control and treated oil palm root samples were converted into cDNA by using the Omniscript two step Reverse Transcription Kit for cDNA Synthesis (Qiagen, USA) following the manufacturer’s instructions. The resulted sequences shown significant similarities to RIP (Naher et al., 2011). 3.3 Expression profiling Expression levels were calculated by Quantity One 1-D Analysis software 4.6.5 (Bio-Rad) according to the manufacturer’s instructions. PCR products were resolved on 1.5%(w/v) agarose gel (1xTAE) with a DNA mass standard marker (MassRuler TM DNA Ladder, Fermentas). The density of the DNA mass standard dilution series was used to generate calibration curve for absolute quantisation of sample bands by linear regression with extrapolation to zero for each experiment. The density of each sample band was then converted to an absolute quantity using the calibration curve. For each sample band was then converted to an absolute quantity using the calibration curve. For each experiment, the relative band quantity obtained by densitometrric analysis was normalized to the value of the internal control (house-keeping gene) bands which were run in parallel. Identification of differentially expressed genes was based on consistent ford-change across experimental replicates relative to untreate d negative control. Fold changes of ≠¥2- fold or ≠¤0.5-fold were considered as significant. 3.4 Statistical analysis A one-way analysis of variance (ANOVA) was used to determine statistical differences (SPSS version 17;SPSS Inc., Chicago, IL). When the ANOVA was significant at P 0.05 the Duncan’s multiple range test was used for means comparison. The t-test was used to compare between group means.(Alizadeh et al., 2011) 4. Results 4.1 sequence analysis EgRIP-1b The partial cDNA of EgRIP-1b (Dr. Ho personal comment) encodes a putative type I ribosome inactivating protein. The partial sequence consists 167 nucleotide residues. (Fig. 2). This sequence has the highest identity with RIP type I from Populus trichocarpa (98%, XP_002328056.1), Hordeum vulgare (90%, AAA32951.1) and Chain A, Structure Of Mutant Rip From Barley Seeds (90%, 4FBA_A). The NODE_77734GT was classified in a RIP-like superfamily. A putative conserved domain of catalytic residues and some RIP family domain were in this sequence, including that it is a member of the RIP superfamily.(Fig. 5) (Naher et al., 2011) M I C E S I R F E R I S E F L A T E F P G S S K P P K TGATGATCTGCGAGTCGATTAGATTCGAACGCATCTCCGAATTTCTTGCTACCGAATTCCCCGGCAGTTCGAAACCCCCTAAA W M P A L E H G W G D L S A A L L R A D A N P D R P F TGGATGCCGGCACTCGAGCACGGCTGGGGAGATCTCTTTGCCGCGTTGCTGCGCGCCGATGCCAATCCCGACCGTCCCTTCA Fig. 2. The nucleotide and deduced amino acid sequences of NODE_77734GT. 4.2 sequence analysis EgRIP-1a The partial cDNA sequence EgRIP-1a (GenBank ID: ) encodes a protein of 17 amino acid. The sequence consists 178 nucleotides (Fig. 3). This sequences has the highest identity with other type I RIPs from Nicotiana tabacum (47%, ABY71831.1), Musa acuminate (47%, ABY71832.1), Alocasia macrorrhizos (47%, ABY71829.1), Agave sisalana (47%, ABY71828.1) (Fig. 6.a) and (Fig. 6.b) M R P T P N F H Y E W S A CAGGATTCCAGCCGAGCTCCTGCGATAGCCGAACTTCTACCACATGCGACCTACTCCAAACTTCCACTACGAGTGGTCTGCTC L S K Q TCTCCAAACAA Fig. 3. The nucleotide and deduced amino acid sequences of EgRIP-1a. Fig. 4: multiple alignment of NODE with other type I RIPs. Amino acid residues that are identical in all sequences are highlighted in black while amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. (a) (b) Fig. 5: Multiple alignment of EgRIP-1a with other RIPs. The protein sequences and their accession numbers used for analysis of detected sequence. a) Nucleotide residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. b) Amino acid residues that are identical in all sequences are highlighted in black with amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. 4.3 Expression profiles (of RIP) in oil palm root upon Ganoderma inoculation A total of 2 cDNA sequences encoding putative defence-related proteins from oil palm were chosen for gene expression profiling in this study. A relative semi-quantification of EgRIP-1b and EgRIP-1b transcripts were performed by calibrating the expression of each gene with an endogenous control, actin. Fig.6 Shows the relative expression level of EgRIP-1b in roots and basal stems in response to the inoculation of G. boninense at different time points compared with that of negative control plants. In G. boninense-treated plants, the gene expression of EgRIP-1b in oil palm roots at 2 wpi was induced. The expression level were n- and n-fold of the uninfected root tissues at 8 and 12 wpi, respectively.(Naher et al., 2011) The expression level was studied in 3 replication of each sample, there were no significant (P>0.05) differences in expression levels in inoculated plants (Alizadeh et al., 2011). EgRIP-1a was up-regulated n-fold and n-fold at X wpi, respectively; before the transcript level decrease at Y wpi in oil palm root tissue following G.boninense infection (Fig). EgRIP-1a expression level were m-, m- and m-fold of the uninfected basal stem tissues at 2,4, 8 and 12 wpi, respectively. EgRIP-1b and EgRIP-1a were not expressed in time zero, untreated samples and leaf tissues. (I) diseased (II) healthy (a) (b) (c) Fig. 6. Differential expression of EgRIP-1b in variety tissues in response to I) G.boninese treatment compare to those in II )control.. a) root tissue, b) stem cell tissue, c) standard (Rippmann et al., 1997) a) b) Fig. 7. Expression level mean in each biological replicate a) in root; b) in stem (I) diseased (II) healthy (a) (b) (c) Fig. 8. Differential expression of EgRIP-1a in variety tissues in response to I) G.boninese treatment compare to those in II) control.. a) root tissue, b) stem cell tissue, c) leaf tissue d)control (Rippmann et al., 1997) a) b) Fig. 9. Expression level mean in each biological replicate a) in root; b) in stem Fig. 10. Semi-quantification of oil palm EgRIP-1a and EgRIP-1b expression levels in root tissues at 2-12 week after inoculation with G.boninense. Significant up-regulation of gene expression compared to untreated negative control. References Alizadeh F, Abdullah SNA, Chong PP, Selamat A Bin (2013) Expression Analysis of Fatty Acid Biosynthetic Pathway Genes during Interactions of Oil Palm (Elaeis guineensis Jacq.) with the Pathogenic Ganoderma boninense and Symbiotic Trichoderma harzianum Fungal Organisms. Plant Molecular Biology Reporter. doi: 10.1007/s11105-013-0595-y Durand-Gasselin T, Asmady H, Flori a, et al. (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninenseprospects for future breeding. Mycopathologia 159:93–100. doi: 10.1007/s11046-004-4429-1 Ho YW, Nawawi A (1985) Ganoderma boninense Pat . from Basal Stem Rot of Oil Palm ( Elaeis guineensis ) in Peninsular Malaysia. Pertanika 8:425–428. Idris AS, Kushairi A, Ismail S, Ariffin D (2004) SELECTION FOR PARTIAL RESISTANCE IN OIL PALM PROGENIES TO Ganoderma BASAL STEM ROT. Journal of Oil Palm Research 16:12–18. Murphy DJ (2009) Oil palm: future prospects for yield and quality improvements. Lipid Technology 21:257–260. doi: 10.1002/lite.200900067 Paterson R (2007) Ganoderma disease of oil palm—A white rot perspective necessary for integrated control. Crop Protection. doi: 10.1016/j.cropro.2006.11.009 pilotti CA (2005) Stem rots of oil palm caused by Ganoderma boninense: Pathogen biology and epidemiology. Mycopathologia 159:129–137. Rees RW, Flood J, Hasan Y, et al. (2009) Basal stem rot of oil palm ( Elaeis guineensis ); mode of root infection and lower stem invasion by Ganoderma boninense. Plant Pathology 58:982–989. doi: 10.1111/j.1365-3059.2009.02100.x Rees RW, Flood J, Hasan Y, Cooper RM (2007) Effects of inoculum potential, shading and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathology. doi: 10.1111/j.1365-3059.2007.01621.x Tan Y-C, Yeoh K-A, Wong M-Y, Ho C-L (2013) Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense. Journal of plant physiology. doi: 10.1016/j.jplph.2013.05.009

Language in Wilfred Owens The Sentry :: essays research papers

Wilfred Owen’s ‘The Sentry’ To me Wilfred Owen’s poetry is visually descriptive, so much so that he seems to be able to effortlessly transport you into whatever situation he is describing. This particular poem leaves you in no doubt as to the horrors of war and the terrible atrocities these poor men endured. In the opening line he says ‘and he knew’ using the technique of personalisation he has turned the massive opposing force into a single person, someone who was actively trying to single them out, to attack them personally. This shows you just how desperate they felt and how to them no matter where they seemed to find shelter ‘he’ was never far behind. He goes on to say ‘and gave us hell for shell on frantic shell hammered on top, but never quite got through’. By using the word ‘hell’ he is actively describing the terrible endlessness of their situation or the perseverance of the enemy and the fact that they cannot escape. enduring the onslaught, hour on hour, day by day. ‘Frantic shell’ the word frantic to me describes the non-target based shelling, as the enemy knew they that their enemy was somewhere in front of them, so just seemed to shell anywhere within that vicinity in the sure hope that they would be causing death eventually. The use of the rhyming words ‘hell’ and ‘shell’ automatically connects the two words in the reader’s brain, forming a connection and reinforcing the idea of the battle being ‘hell’. ‘Hammered’is also a very thought provoking verb used in this line, this word used in this particular sentence is brilliant, it not only describes the noise, as you cannot hammer quietly, but describes the repetition, when hammering something you repeatedly strike it. Hammered is a violent verb and its two syllables makes the word sound short and harsh. In the following line, ‘rain, guttering down’ this makes me think the guttering I have on my house, a purpose made moulded channel used to transport water. He deliberately used this word to convey just how much rain had fallen that it had naturally moulded gutters out of the mud, channelling the slime and slurry into waterfalls. There is also assonance in this sentence emphasising the guttering (which I have already analysed above). Wilfred Owen is cleverly able to relate to you a description of a bomb without ever actually calling it a bomb.

Margins: Meaning of Life and Frazier Essay

In Ian Frazier’s essay, â€Å"In Praise of Margins†, the author talks about his childhood life and how he had â€Å"margins† where he and his friends would do things and nothing would matter because they wouldn’t care. â€Å"Marginal† thought is valuable because it allows adults to use their imagination. His purpose is to try new activities without shame; it’s the spur of the moment that defines margin. I think his view about marginal activity is comprehensive and relatable. When we think of margins, we think of the extra space on the edge of the paper that we can’t write out of. But marginal has another meaning to it which has to do with the economic world and how we function with margins in our life such as personal experiences. Marginal space is key to the coming of age process in each person’s life whether we share the same activities or not. Although it’s not easy to pin point it out but marginal spaces are needed to escape from everyone’s present problem in everyday life. I agree and believe with Frazier when he is talking about the meaning of marginal because it is true that margins sometimes do not come out the way you want it to be, nothing or nobody is perfect and there are always something ruining the perfect moment that we all have or want. Marginal act take such a high valued meaning according to Frazier because the places and activities that he discovered through his childhood is something that has been lost in the past and also in many societies, especially the economic society. According to Frazier, he added, â€Å"†¦the margin is where you can try out ideas that you might be afraid to admit to with people looking on. † (7) This is an important concept to anyone’s life. One person’s marginal space can different from another person’s as long as it is an activity in which the person escapes from reality. In an economic society, time is considered money and Frazier’s activity of sitting on a tree for hours is more on the lines of suicidal, in economic society’s terms. Frazier agreed that he felt useless at the time of just sitting but as he grew older, the useless time of gazing off turned into something sacred towards him. The sitting in the tree gave him memories and something to reflect back on. It came upon me when I took my nephews out to the ice rink at the Christmas in the Park; I realized if I never done this I would have missed out on what defined me as of today. Though it’s all fun and games I know that it’s one of the activities you can do once in a while that can take you away from your stress and busy day life-style. Reflection cannot happen when there is nothing to look back on. There are always memories that others have whether it be good or bad. It might be their first time driving or their first time swimming. Any memory is something someone can reflect back onto to see who they are and to see how they got to the place they are now. The economic society always keeps moving on and thinks about the future, while human beings need time to focus and reminisce from where they came from. If someone keeps running straight with their heads down, they might get far but eventually, they will get lost. In order to stay on track and know where you’re heading, at times the person needs to look back to see where they started from. Know where you are is the most important thing to knowing who you are and Frazier realized the great importance of that. Frazier’s useless â€Å"marginal† activity such as just plainly sitting brought out the importance of just doing things not to gain a profit but to gain something to reflect on. When Frazier was younger, he had his own marginal place and would always go out to â€Å"the woods†; it was his â€Å"part-time address, destination, purpose, and excuse† (1). While Frazier ran around bumping into bushes and branches, slipping and sliding through thick brown dirt; I was ice skating at the ice arena, hop-scotching, and playing house. Throughout my childhood, I dedicated numerous hours in the freezing cold ice arena at the local mall, hop-scotched afterschool with my neighbors, and played house on the weekends with my cousins. These activities may sound typical as a child but it had a significant meaning towards me. It was my purpose to grow upon these marginal experiences. In the end, all that matters is being able to free your mind from something that you free yourself from caring about what others think. And I believe that I accomplish my marginal activity as a child, through every fall and bruises that I received while ice skating, I couldn’t care less about what others had to say about me because I knew that every time I got up it’ll only make me a better skater in the end. Although changes occurred and I grew out of the marginal acts, agreeing with Frazier’s realization, â€Å"†¦and suddenly there was nothing up there for us. † (4) The excitement of skating on the slipping cold ice with no shame of failing can only be done as a marginal act, because I can no longer look at the rink the same way I did when I was younger. Nor can I play hop-scotch the way I did, hopping from one box to another is like going from one class to another today. Instead of playing house with my cousins, we became college students looking for a stable job that can support our education. I agree with Frazier that the â€Å"remember whens† really does faltered and â€Å"playing† time doesn’t have to end here. Although margins can be done differently and looked at differently, marginal is necessary for a person of all ages to let loose in order to overcome the pressure and stresses of everyday life. Frazier’s marginal activities consisted of breaking ice, climbing trees, and picking fruits. My marginal activities consisted of ice skating, hop-scotching, and playing house. Marginal activities may vary from being active in a sport, traveling, singing or perhaps even enjoying a movie night on the couch; by the end of the day marginal activities is necessary in order to free yourself from the strains of everyday life.

Long-term Negative Effect of Breatharianism

A reason behind I became a breatharian is to maintain a slim figure, living healthy, and happy. Unfortunately, any of those my wish doesn’t come true. That’s why I decided to inform the vice squad for further investigation into the organization. The breatharian diet neither includes food nor water. However, after seeing several YouTube video and commercial on flyer, I was convinced by the specious way to live life. Once I enrolled, I came to know many things, for example, some of the main people of the organization not even follow their own instruction which is not to eat or drink. I would like to share my personal experience and that is I am completely unsatisfied with diet plan and even their promises. They said to me that, â€Å"if you live only on light and air, you became healthier and happier more than you are right now. † Nevertheless, just following there instruction I became ill. I had to visit an emergency room of hospital twice a month. Now, I am suffering from high blood pressure. That’s just my experience. One of my friends also enrolled in this program and she is suffering from renal disease. I want to submit this report against the organization, because I feel their only purpose is to make money out of people like us. They are making this money by enrolment and seminar fees. In addition to that, after one month experience of being part of their program, I feel that they not follow their own instruction. I saw one of them eating outside the Taco Bell. The diet plans they provide are dangerous and lead many lives in danger. After all it’s our moral duty to save local citizen. It’s my humble request to take a step towards the organization.

Cross Culture

Introduction: Introduction Communication is the process by which information is transmitted between individuals and/or organizations so that an understanding response results. Simply we can say, Communication is an exchange of facts, ideas, opinions or emotions by two or more person. The transmission of the sender’s ideas to the receiver and the receiver’s feedback or reaction to the sender constitute the communication cycle. SENDERRECEIVER InputOutput [pic] Feedback Brain drain Brain drain Brain drain Fig- 01: Communication Cycle Culture is an idea in the field of management which describes the psychology, attitudes, experiences, beliefs and values (personal and cultural values) of an organization. Culture is a complex concept. In other words, culture is central to what we see, how we make sense of what we see, and how we express ourselves. Objective of the Report: The Primary Objective of this report is to analysis of cross cultural communication in IBM. The report has accumulated information to know about company’s cross cultural communication, to find out its positive and productive communication in their organization and does the work effectively. Methodology: Sources of data: †¢ Secondary Data: All the data and information are collected from secondary sources. Cross-Cultural Communication: The success of a business depends on its ability to communicate. Communication serves as the medium for instruction, assessment, interpersonal relationships, group interactions and all other interaction that takes place in business. With globalization, business is no longer constrained within the boundaries of a single country. Large business organizations have corporate offices in different parts of the world. They need to communicate in order to promote coordination. Also in multinational companies people from different parts of the world are employed. The way an individual communicates, is influenced by his or her culture. Hence in today’s increasing global economy, it is important for managers and employees at all levels to understand, appreciate, and manage the impact of cross-cultural communication in the workplace. As our world grows, expands and becomes increasingly more interconnected by various technological advances, the need for effective communication among various cultures is increasing. People from different backgrounds tend to perceive information differently. Hence, misinterpretation of information can lead to conflict. Cross cultural communication is of great importance through out the world. Though in our country, due to the lack of cultural diversity, cross cultural communication is not treated with that much importance. But still with the advancement of technology we have to interact with businesspeople in faraway countries and for this we need know about effective techniques of cross cultural communication Definition of Cross-Cultural Communication: To understand cross cultural communication first we need to know what culture is. Culture refers to a group or community with which we share common experiences that shape the way we understand the world. Cross-cultural communication looks at how people, from differing cultural backgrounds, endeavor to communicate. It is more frequently referred to as Intercultural communication. (Ramsey, 1999). Culture refers to all the knowledge and values shared by a society. The word culture is often considered in terms of nationality or one's country of origin. Other more specific distinguishing characteristics of culture are region, orientation, socioeconomic status, gender, sexual orientation and preference, age, marital and parental status. Another approach to understanding the concept of culture involves the beliefs, values and norms that exist to guide an individual's behaviors in solving common problems. Culture is the acquired knowledge people use to interpret experience and generate behavior (Porter, 1991). Culture is the shared customs, beliefs, and social structures that make up a society, including languages, rules, myths, family patterns, and political systems. (Boone et al. 1997). Cross cultural communication is a symbolic, interpretive, transactional, contextual processing tool with which people from different cultures create shared meanings (Berko et al. , 1997). When we speak to someone with whom we share little or no cultural bond, it is referred to as cross cultural communication. Our need to communicate across culture can be very beneficial personally and professionally. Within an intercultural setting, nonverbal and verbal communications are both prevalent in emphasizing the differences in cultures. The way we act and the things we say determine whether or not we belong in a certain culture. Nonverbal communication systems provide information about the meaning associated with the use of space, time, touch and gestures. They help to define the boundaries between the members and nonmembers of a culture (Hofstede, 1991). Hence, Cross Cultural Communication is the communication that takes place among people from different cultures. Cross cultural communication does not only mean face to face communication it includes all forms of written and oral communication. History of Cross-Cultural Communication: The need for Cross-Cultural communication was felt with the spread of global commerce. It is very tough to get the specific date when cross-cultural communication started. Initial initiatives in cross-cultural communication were taken in different countries in different time period. One of the pioneers of the computer industry, IBM started cross cultural communication in 1953. It was introduced by the CEO of that time Thomas J. Watson Jnr. According to Thomas it was the policy of IBM to hire talented people regardless of race, color and background. During 1978-83, the Dutch cultural anthropologist Geert Hofstede conducted detailed interviews with hundreds of IBM employees in 53 countries. Through standard statistical analysis of fairly large data sets, he was able to determine patterns of similarities and differences among the replies. In the year 1991, Geert Hofstede undertook the first global studies on how a specific business culture, at the time one of the most widely distributed companies, interacted with the local cultures of some 39 different countries. Another professional development initiative is IBM’s Shade of blues – a more in-depth program for managers who are engaged in cross-cultural business interactions or have multicultural teams. Recent Research on Cross-Cultural Communication: As people from different cultural groups take on the exciting challenge of working together, cultural values sometimes conflict. We can misunderstand each other, and react in ways that can hinder what are otherwise promising partnerships. Oftentimes, we aren't aware that culture is acting upon us. Sometimes, we are not even aware that we have cultural values or assumptions that are different from others. One of the major barriers in business communication is cultural diversity. Many communication researchers are trying to find out new and effective ways to improve cross cultural communication. In many cases patients face problems with both translation difficulties and not being able to see the type clearly. As a result they are sometimes unable to take their prescriptions correctly. Many of the pharmaceuticals around the world have been trying to solve this problem. Recently they have come up with a tool which can print instructions for taking medicine in 11 different languages on the prescription bottle labels. Patients no longer have to depend on translation from a friend or relative to make sure they are taking their prescriptions correctly. The languages include English, Spanish, French, Arabic, Korean, Chinese, Japanese, Hindi, Polish, Russian or Portuguese. The tool is also equipped to print a 20- point type versus the typical smaller type, for those patients who prefer larger printed labels on the bottle labels to easily identify their medicines and how to take them. On July 6, 2005 Mark Nash, an American entrepreneur created a cross-cultural website created especially for non-resident Indians and offshore call center personnel (Nash, 2005). The website www. intro2america. om was designed to provide information about American culture. It was also designed to provide information to call center personnel who speak with Americans on a daily basis as part of their job responsibilities. The site is designed to make the transition to American lifestyle easier and reduce the difficulties & misunderstandings upon first moving to the States. The site provides useful information, which is related specifically to cross-cultural types of issues. Moving from an Asian culture to a Western culture can be challenging. The site was designed for the specific purpose of easing the transition to American way of life, for those who are moving to the United States (See Appendix for the sample of the website). To serve customers from diversified cultures, they have taken a great deal of effort and time to analyze what their customers around the globe want. To achieve this they are trying to understand their customer’s behavior, cultural and spending patterns when they fly with Malaysia Airlines. The airliner has successfully catered to the demands of wide variety global customers around the world. Application in the work place: IBM, the leading business organization in computer sector, has a huge diverse workforce from the very beginning. They have concentration to manage the cross cultural communication among these employees. Here we have selected IBM’s Australia branch to present as an example of cross cultural environment where employees are working together with their cultural differences. IBM has developed their cross-cultural program based on the legal requirements of Anti- Discrimination Act & Racial Discrimination Act and corporate values. IBM’s policies on cultural diversity are based on years of corporate experience. It is a long-held view that by valuing diversity, it uncovers new perspectives, taps different knowledge and experience and generates innovative ideas, suggestions and methods. Three pillars that are in place to make up IBM’s diversity strategy are: †¢ Creating a work/life balance: Their strategy is to find the average working age of general Australians through statistical findings and fix age limit for average Australians. †¢ Advancement of women: They think women should contribute more to the workplace. So, they encourage participation of women. †¢ Integration of people with a disability: IBM authority thinks that they have a social responsibility for physically and mentally disable people. The authority always tries to create some opportunity of employment for those people. IBM’s most effective diversity programs combine ‘push and pull’ strategies. They have made good headway through company-led, top down practices such as formalized training or policies like floating cultural holidays. However, IBM’s progress comes about through the contributions by individuals who are passionate about diversity issue. Aside from IBM’s diversity team within human resources, three other groups within IBM have formally identified roles in the implementation of the company’s overall diversity strategy. These are IBM’s Diversity Council, diversity contact officers and diversity champions. The Diversity Council The main objective of the IBM’s Diversity Council, is to ensure that the contribution of employees from different background is properly encouraged and valued. Its key objectives are to enhance employee awareness, increase management awareness, and encourage the effective use of IBM’s diverse workforce. This is achieved through personal commitment, regular communication, by gaining support for the program from other IBM managers and influencing decision making. Under the guidance of the Diversity Council, a series of cultural diversity employee roundtables have been held to gather more face-to-face feedback and ideas from staff. These meetings have generated many practical ideas for increasing awareness of cultural diversity within IBM. Professional development IBM has a professional development program. The objective of this program is to ensure that the employees within the organization can identify and remove psychological barriers of diverse workforce and communicate effectively. The main focuses of this program are: †¢ Understanding the cultural bias of each team member and their impact on mutualperceptions. †¢ Determine the reasons why certain behaviors and communication styles fail in somecultures. †¢ Identifying approaches to address cultural gaps that could lead to misunderstandings. †¢ Handling issues about team decision-making, giving or receiving feedback and conflict resolution. Findings: IBM, One of the pioneers of the computer industry started cross cultural communication in 1953. †¢ They think women should contribute more to the workplace. So, they encourage participation of women. †¢ IBM authority thinks that they have a social responsibility for physically and mentally disable people. The authority always tries to create some opportunit y of employment for thosepeople. Recommendations: Considering research and the case of IBM, we have some recommendation here which will decrease discrimination and increase production by making the flow of cross-cultural communication fluent. Those recommendations are as follows: ? IBM should compare their policy for cross cultural communication with others, so that they can get some new ideas to implement in their organization. It will help them to update existing policies as well. ? Not only the HR department of IBM, but also all other employees of the organization should be involved in the process of making cross cultural communication easier. It will help the whole organization to become a good team. ? Training and raising awareness can improve mentality of the employees towards others. They will learn to respect and honor others differences. Place people from different cultures as team leaders. If diverse employees get opportunity to work and share success they will be highly motivated. Discrimination will be dissolved from them and the communication process will work freely. ? A good idea can be to focus different segments one after another so that every segment can achieve expected mentality. This process will form unity and emotion among the employees of the organization. Discrimination will be terminated and the total organization will work as one body. ? Each program introduced in the organization should honor the basic values of the organization. Every program should ensure that none of the employees are discriminated in terms of race, national origin or religion. Conclusion: From the above research we have seen that cultural communication plays a vital role for effective communication for companies around the globe. In our country due to the lack of cultural diversity we do not have to face the problems related to intercultural communication. Many of the successful companies having corporate offices have been able to coordinate their activities through out the world through the successful implementation of cross cultural communication. One of the fore runners in this sector is definitely IBM. IBM has independent division to come up with new policies and strategies to improve cross cultural communication in the workplace. Reference: Boone, L. E. , Kurtz, D. L. , & Block, Judy R. (1997). Contemporary Business Communication (2nd ed. ). Upper Saddle River, New Jersey: Prentince-Hall. 67. Ramsey, James (1999). Available: http://encyclopedia. localcolorart. com/encyclopedia/Cross-cultural_communication/ (July, 17 2005). Carbaugh, D, (1990). Cultural Communication and Intercultural Contact. New York: Pergamon Press. 19. Berko, R. , Rosengeld, L. , & Samovar, L. (1997). Connecting: A Culture Sensitive Approach to Intercultural Communication. Fort Worth, Texas: Harcourt Brace. 121. Porter, R. , and Samovar, L. (1991). Communication Between Cultures. Belmont:NTC Publishing Group. 273. Payne, C. (2001). Culture and Communication. Available: http://www2. mhc. ab. ca/users/cpayne/portfolio/cultcomm/default. htm (July, 29 2005). Appendix [pic] A sample website dedicated to understanding cross-cultural types of issues. [pic] ———————– Idea Letter, Fax, Phone call, E-mail etc. Idea Cross Culture Introduction: Introduction Communication is the process by which information is transmitted between individuals and/or organizations so that an understanding response results. Simply we can say, Communication is an exchange of facts, ideas, opinions or emotions by two or more person. The transmission of the sender’s ideas to the receiver and the receiver’s feedback or reaction to the sender constitute the communication cycle. SENDERRECEIVER InputOutput [pic] Feedback Brain drain Brain drain Brain drain Fig- 01: Communication Cycle Culture is an idea in the field of management which describes the psychology, attitudes, experiences, beliefs and values (personal and cultural values) of an organization. Culture is a complex concept. In other words, culture is central to what we see, how we make sense of what we see, and how we express ourselves. Objective of the Report: The Primary Objective of this report is to analysis of cross cultural communication in IBM. The report has accumulated information to know about company’s cross cultural communication, to find out its positive and productive communication in their organization and does the work effectively. Methodology: Sources of data: †¢ Secondary Data: All the data and information are collected from secondary sources. Cross-Cultural Communication: The success of a business depends on its ability to communicate. Communication serves as the medium for instruction, assessment, interpersonal relationships, group interactions and all other interaction that takes place in business. With globalization, business is no longer constrained within the boundaries of a single country. Large business organizations have corporate offices in different parts of the world. They need to communicate in order to promote coordination. Also in multinational companies people from different parts of the world are employed. The way an individual communicates, is influenced by his or her culture. Hence in today’s increasing global economy, it is important for managers and employees at all levels to understand, appreciate, and manage the impact of cross-cultural communication in the workplace. As our world grows, expands and becomes increasingly more interconnected by various technological advances, the need for effective communication among various cultures is increasing. People from different backgrounds tend to perceive information differently. Hence, misinterpretation of information can lead to conflict. Cross cultural communication is of great importance through out the world. Though in our country, due to the lack of cultural diversity, cross cultural communication is not treated with that much importance. But still with the advancement of technology we have to interact with businesspeople in faraway countries and for this we need know about effective techniques of cross cultural communication Definition of Cross-Cultural Communication: To understand cross cultural communication first we need to know what culture is. Culture refers to a group or community with which we share common experiences that shape the way we understand the world. Cross-cultural communication looks at how people, from differing cultural backgrounds, endeavor to communicate. It is more frequently referred to as Intercultural communication. (Ramsey, 1999). Culture refers to all the knowledge and values shared by a society. The word culture is often considered in terms of nationality or one's country of origin. Other more specific distinguishing characteristics of culture are region, orientation, socioeconomic status, gender, sexual orientation and preference, age, marital and parental status. Another approach to understanding the concept of culture involves the beliefs, values and norms that exist to guide an individual's behaviors in solving common problems. Culture is the acquired knowledge people use to interpret experience and generate behavior (Porter, 1991). Culture is the shared customs, beliefs, and social structures that make up a society, including languages, rules, myths, family patterns, and political systems. (Boone et al. 1997). Cross cultural communication is a symbolic, interpretive, transactional, contextual processing tool with which people from different cultures create shared meanings (Berko et al. , 1997). When we speak to someone with whom we share little or no cultural bond, it is referred to as cross cultural communication. Our need to communicate across culture can be very beneficial personally and professionally. Within an intercultural setting, nonverbal and verbal communications are both prevalent in emphasizing the differences in cultures. The way we act and the things we say determine whether or not we belong in a certain culture. Nonverbal communication systems provide information about the meaning associated with the use of space, time, touch and gestures. They help to define the boundaries between the members and nonmembers of a culture (Hofstede, 1991). Hence, Cross Cultural Communication is the communication that takes place among people from different cultures. Cross cultural communication does not only mean face to face communication it includes all forms of written and oral communication. History of Cross-Cultural Communication: The need for Cross-Cultural communication was felt with the spread of global commerce. It is very tough to get the specific date when cross-cultural communication started. Initial initiatives in cross-cultural communication were taken in different countries in different time period. One of the pioneers of the computer industry, IBM started cross cultural communication in 1953. It was introduced by the CEO of that time Thomas J. Watson Jnr. According to Thomas it was the policy of IBM to hire talented people regardless of race, color and background. During 1978-83, the Dutch cultural anthropologist Geert Hofstede conducted detailed interviews with hundreds of IBM employees in 53 countries. Through standard statistical analysis of fairly large data sets, he was able to determine patterns of similarities and differences among the replies. In the year 1991, Geert Hofstede undertook the first global studies on how a specific business culture, at the time one of the most widely distributed companies, interacted with the local cultures of some 39 different countries. Another professional development initiative is IBM’s Shade of blues – a more in-depth program for managers who are engaged in cross-cultural business interactions or have multicultural teams. Recent Research on Cross-Cultural Communication: As people from different cultural groups take on the exciting challenge of working together, cultural values sometimes conflict. We can misunderstand each other, and react in ways that can hinder what are otherwise promising partnerships. Oftentimes, we aren't aware that culture is acting upon us. Sometimes, we are not even aware that we have cultural values or assumptions that are different from others. One of the major barriers in business communication is cultural diversity. Many communication researchers are trying to find out new and effective ways to improve cross cultural communication. In many cases patients face problems with both translation difficulties and not being able to see the type clearly. As a result they are sometimes unable to take their prescriptions correctly. Many of the pharmaceuticals around the world have been trying to solve this problem. Recently they have come up with a tool which can print instructions for taking medicine in 11 different languages on the prescription bottle labels. Patients no longer have to depend on translation from a friend or relative to make sure they are taking their prescriptions correctly. The languages include English, Spanish, French, Arabic, Korean, Chinese, Japanese, Hindi, Polish, Russian or Portuguese. The tool is also equipped to print a 20- point type versus the typical smaller type, for those patients who prefer larger printed labels on the bottle labels to easily identify their medicines and how to take them. On July 6, 2005 Mark Nash, an American entrepreneur created a cross-cultural website created especially for non-resident Indians and offshore call center personnel (Nash, 2005). The website www. intro2america. om was designed to provide information about American culture. It was also designed to provide information to call center personnel who speak with Americans on a daily basis as part of their job responsibilities. The site is designed to make the transition to American lifestyle easier and reduce the difficulties & misunderstandings upon first moving to the States. The site provides useful information, which is related specifically to cross-cultural types of issues. Moving from an Asian culture to a Western culture can be challenging. The site was designed for the specific purpose of easing the transition to American way of life, for those who are moving to the United States (See Appendix for the sample of the website). To serve customers from diversified cultures, they have taken a great deal of effort and time to analyze what their customers around the globe want. To achieve this they are trying to understand their customer’s behavior, cultural and spending patterns when they fly with Malaysia Airlines. The airliner has successfully catered to the demands of wide variety global customers around the world. Application in the work place: IBM, the leading business organization in computer sector, has a huge diverse workforce from the very beginning. They have concentration to manage the cross cultural communication among these employees. Here we have selected IBM’s Australia branch to present as an example of cross cultural environment where employees are working together with their cultural differences. IBM has developed their cross-cultural program based on the legal requirements of Anti- Discrimination Act & Racial Discrimination Act and corporate values. IBM’s policies on cultural diversity are based on years of corporate experience. It is a long-held view that by valuing diversity, it uncovers new perspectives, taps different knowledge and experience and generates innovative ideas, suggestions and methods. Three pillars that are in place to make up IBM’s diversity strategy are: †¢ Creating a work/life balance: Their strategy is to find the average working age of general Australians through statistical findings and fix age limit for average Australians. †¢ Advancement of women: They think women should contribute more to the workplace. So, they encourage participation of women. †¢ Integration of people with a disability: IBM authority thinks that they have a social responsibility for physically and mentally disable people. The authority always tries to create some opportunity of employment for those people. IBM’s most effective diversity programs combine ‘push and pull’ strategies. They have made good headway through company-led, top down practices such as formalized training or policies like floating cultural holidays. However, IBM’s progress comes about through the contributions by individuals who are passionate about diversity issue. Aside from IBM’s diversity team within human resources, three other groups within IBM have formally identified roles in the implementation of the company’s overall diversity strategy. These are IBM’s Diversity Council, diversity contact officers and diversity champions. The Diversity Council The main objective of the IBM’s Diversity Council, is to ensure that the contribution of employees from different background is properly encouraged and valued. Its key objectives are to enhance employee awareness, increase management awareness, and encourage the effective use of IBM’s diverse workforce. This is achieved through personal commitment, regular communication, by gaining support for the program from other IBM managers and influencing decision making. Under the guidance of the Diversity Council, a series of cultural diversity employee roundtables have been held to gather more face-to-face feedback and ideas from staff. These meetings have generated many practical ideas for increasing awareness of cultural diversity within IBM. Professional development IBM has a professional development program. The objective of this program is to ensure that the employees within the organization can identify and remove psychological barriers of diverse workforce and communicate effectively. The main focuses of this program are: †¢ Understanding the cultural bias of each team member and their impact on mutualperceptions. †¢ Determine the reasons why certain behaviors and communication styles fail in somecultures. †¢ Identifying approaches to address cultural gaps that could lead to misunderstandings. †¢ Handling issues about team decision-making, giving or receiving feedback and conflict resolution. Findings: IBM, One of the pioneers of the computer industry started cross cultural communication in 1953. †¢ They think women should contribute more to the workplace. So, they encourage participation of women. †¢ IBM authority thinks that they have a social responsibility for physically and mentally disable people. The authority always tries to create some opportunit y of employment for thosepeople. Recommendations: Considering research and the case of IBM, we have some recommendation here which will decrease discrimination and increase production by making the flow of cross-cultural communication fluent. Those recommendations are as follows: ? IBM should compare their policy for cross cultural communication with others, so that they can get some new ideas to implement in their organization. It will help them to update existing policies as well. ? Not only the HR department of IBM, but also all other employees of the organization should be involved in the process of making cross cultural communication easier. It will help the whole organization to become a good team. ? Training and raising awareness can improve mentality of the employees towards others. They will learn to respect and honor others differences. Place people from different cultures as team leaders. If diverse employees get opportunity to work and share success they will be highly motivated. Discrimination will be dissolved from them and the communication process will work freely. ? A good idea can be to focus different segments one after another so that every segment can achieve expected mentality. This process will form unity and emotion among the employees of the organization. Discrimination will be terminated and the total organization will work as one body. ? Each program introduced in the organization should honor the basic values of the organization. Every program should ensure that none of the employees are discriminated in terms of race, national origin or religion. Conclusion: From the above research we have seen that cultural communication plays a vital role for effective communication for companies around the globe. In our country due to the lack of cultural diversity we do not have to face the problems related to intercultural communication. Many of the successful companies having corporate offices have been able to coordinate their activities through out the world through the successful implementation of cross cultural communication. One of the fore runners in this sector is definitely IBM. IBM has independent division to come up with new policies and strategies to improve cross cultural communication in the workplace. Reference: Boone, L. E. , Kurtz, D. L. , & Block, Judy R. (1997). Contemporary Business Communication (2nd ed. ). Upper Saddle River, New Jersey: Prentince-Hall. 67. Ramsey, James (1999). Available: http://encyclopedia. localcolorart. com/encyclopedia/Cross-cultural_communication/ (July, 17 2005). Carbaugh, D, (1990). Cultural Communication and Intercultural Contact. New York: Pergamon Press. 19. Berko, R. , Rosengeld, L. , & Samovar, L. (1997). Connecting: A Culture Sensitive Approach to Intercultural Communication. Fort Worth, Texas: Harcourt Brace. 121. Porter, R. , and Samovar, L. (1991). Communication Between Cultures. Belmont:NTC Publishing Group. 273. Payne, C. (2001). Culture and Communication. Available: http://www2. mhc. ab. ca/users/cpayne/portfolio/cultcomm/default. htm (July, 29 2005). Appendix [pic] A sample website dedicated to understanding cross-cultural types of issues. [pic] ———————– Idea Letter, Fax, Phone call, E-mail etc. Idea